Skip to Main Content
Table 1.

Primers for RT-PCR

GeneForward primer 5′-3′Reverse primer 5′-3′CyclesReferences
Axin AAGGCCAGACCTAGACTTGG CGAACTGTCTAACGCAAGC 32 Hedgepeth et al., 1999 
Bra GCTGGAAGTATGTGAATGGAG TTAAGTGCTGTAATCTCTTCA 32 Agius et al., 2000 
CD44 CAAGCGCGTACAGTTATCAGC TACAGAGTCTCCCTGGTATCC 32 Ori et al., 2006 
Coll2 AGGCTTGGCTGGTCCTCAAGGT TGTAACGCATAGGGTCGGGTCC 30 Sasai et al., 1996 
Delta-1 AAGCCCAGGTACCCTTCTGT GGCAGAGTCTGGTCGTCTTC 30 Abe et al., 2004 
EF1α CCTGAACCACCCAGGCCAGATTGGTG GAGGGTAGTCAGAGAAGCTCTCCACG 20-22 Agius et al., 2000 
FGF8 CTGCGTCTTCTCGGAAATTGTC GTTTTTATGAAGTCTGTGGAACG 32 Lin and Slack, 2008 
Has1 CATGAAGCCATTCTCTTCTC ACACGTCTTTGAACATCTCC 30 Unpublished 
Has2 GTAACGCAGATGGTTCTCTC GTTAAACGCCATCCAGTATC 28-30 Unpublished 
Has3 GGGACAAAAATTACCATGAA CAGAAATGAGATCCACGATT 35 Unpublished 
Hyal2 TGCAGAGGACATTGCTGTTC TAAGAGGTGATGGGGTCAGC 32 Vigetti et al., 2003 
Msx1 GCTAAAAATGGCTGCTAA AGGTGGGCTGTGTAAAGT 30 Unpublished* 
Msx2 CACCTTCATTTAGGGATCAG GTTTTGTGCTTCCTCAAAGT 30 Unpublished 
RHAMM CAAACAAGTGGCGCACCC AGTCATTGCCCAGTCAGC 32 Groen et al., 2004 
Shh CTTCGCTCGGACGAGATGCTGG CCTTCGTATCTGCCGCTGGCC 30 Sigiura et al., 2004 
Syn-1 TACATCTGCGTTGCCTTCTG TGGATTTCACAGTGGTTGGA 30 Olivares et al., 2009 
Wnt5a AAGGACTCTCCCATCTTGTT AGAAAAGGCACTTCACACAG 30 Sigiura et al., 2004 
GeneForward primer 5′-3′Reverse primer 5′-3′CyclesReferences
Axin AAGGCCAGACCTAGACTTGG CGAACTGTCTAACGCAAGC 32 Hedgepeth et al., 1999 
Bra GCTGGAAGTATGTGAATGGAG TTAAGTGCTGTAATCTCTTCA 32 Agius et al., 2000 
CD44 CAAGCGCGTACAGTTATCAGC TACAGAGTCTCCCTGGTATCC 32 Ori et al., 2006 
Coll2 AGGCTTGGCTGGTCCTCAAGGT TGTAACGCATAGGGTCGGGTCC 30 Sasai et al., 1996 
Delta-1 AAGCCCAGGTACCCTTCTGT GGCAGAGTCTGGTCGTCTTC 30 Abe et al., 2004 
EF1α CCTGAACCACCCAGGCCAGATTGGTG GAGGGTAGTCAGAGAAGCTCTCCACG 20-22 Agius et al., 2000 
FGF8 CTGCGTCTTCTCGGAAATTGTC GTTTTTATGAAGTCTGTGGAACG 32 Lin and Slack, 2008 
Has1 CATGAAGCCATTCTCTTCTC ACACGTCTTTGAACATCTCC 30 Unpublished 
Has2 GTAACGCAGATGGTTCTCTC GTTAAACGCCATCCAGTATC 28-30 Unpublished 
Has3 GGGACAAAAATTACCATGAA CAGAAATGAGATCCACGATT 35 Unpublished 
Hyal2 TGCAGAGGACATTGCTGTTC TAAGAGGTGATGGGGTCAGC 32 Vigetti et al., 2003 
Msx1 GCTAAAAATGGCTGCTAA AGGTGGGCTGTGTAAAGT 30 Unpublished* 
Msx2 CACCTTCATTTAGGGATCAG GTTTTGTGCTTCCTCAAAGT 30 Unpublished 
RHAMM CAAACAAGTGGCGCACCC AGTCATTGCCCAGTCAGC 32 Groen et al., 2004 
Shh CTTCGCTCGGACGAGATGCTGG CCTTCGTATCTGCCGCTGGCC 30 Sigiura et al., 2004 
Syn-1 TACATCTGCGTTGCCTTCTG TGGATTTCACAGTGGTTGGA 30 Olivares et al., 2009 
Wnt5a AAGGACTCTCCCATCTTGTT AGAAAAGGCACTTCACACAG 30 Sigiura et al., 2004 
Close Modal

or Create an Account

Close Modal
Close Modal