Skip to Main Content
Table 2.

ChIP PCR oligonucleotide sequences

RegionForward (5′-3′)Reverse (5′-3′)
Dpp4 - region A CAATCCCTCAAGACTTGCCATAC GAAGGCACCAGCAAGGAAAG 
Dpp4 - region B CCCCATGCCACCAGATACTAA CAACTCGGAATGAACCAAAACA 
Dpp4 - region C TGGGCTACATGCTGAGAAGAAA TTCCAGGAGCACCAGATGAAT 
Dpp4 - region D CTTCAGTGCCTTCCTGGTGAGT CACCAGTGCTGCACTGGAGTA 
Dpp4 - region E CTTTCTTTGCCAGCCAGATAACA TGCAGAAACTAGCTGCCAGTTC 
Scd1 - region A TGTTCTAGTCAAGAGGCATCTCATG TCTGTTTACCCGTCTAACAGGAAAA 
Scd1 - region B GTGGCCTAAAAAGGTGGGAAT GCCAATCAGAAAGCAAGCCTAGT 
Scd1 - region C TTGGGAAGAAAGAGGAAAATAATCC ATGTAACTGTGGTGCGTTTCCA 
RegionForward (5′-3′)Reverse (5′-3′)
Dpp4 - region A CAATCCCTCAAGACTTGCCATAC GAAGGCACCAGCAAGGAAAG 
Dpp4 - region B CCCCATGCCACCAGATACTAA CAACTCGGAATGAACCAAAACA 
Dpp4 - region C TGGGCTACATGCTGAGAAGAAA TTCCAGGAGCACCAGATGAAT 
Dpp4 - region D CTTCAGTGCCTTCCTGGTGAGT CACCAGTGCTGCACTGGAGTA 
Dpp4 - region E CTTTCTTTGCCAGCCAGATAACA TGCAGAAACTAGCTGCCAGTTC 
Scd1 - region A TGTTCTAGTCAAGAGGCATCTCATG TCTGTTTACCCGTCTAACAGGAAAA 
Scd1 - region B GTGGCCTAAAAAGGTGGGAAT GCCAATCAGAAAGCAAGCCTAGT 
Scd1 - region C TTGGGAAGAAAGAGGAAAATAATCC ATGTAACTGTGGTGCGTTTCCA 
Close Modal

or Create an Account

Close Modal
Close Modal