Skip to Main Content
Table 3.

RT-PCR oligonucleotide sequences

GeneForward (5′-3′)Reverse (5′-3′)
Scd1 CACTGAATGCGAGGGTTGGT CCAAAGCCACATTACCTTGCA 
Dpp4 GGTGGATGCTGGTGTGGATT GGCTCATGTGGGAATAGATGTG 
RBP-L GGCGTGCTTCCTGTTTTTGT TCTGGAGAGCAAATCCCCAAT 
CC10 TCCTAACAAGTCCTCTGTGTAAGCA AGGAGACACAGGGCAGTGACA 
SP-B ACGTCCTCTGGAAGCCTTCA TGTCTTCTTGGAGCCACAACAG 
SP-C ACCCTGTGTGGAGAGCTACCA TTTGCGGAGGGTCTTTCCT 
GeneForward (5′-3′)Reverse (5′-3′)
Scd1 CACTGAATGCGAGGGTTGGT CCAAAGCCACATTACCTTGCA 
Dpp4 GGTGGATGCTGGTGTGGATT GGCTCATGTGGGAATAGATGTG 
RBP-L GGCGTGCTTCCTGTTTTTGT TCTGGAGAGCAAATCCCCAAT 
CC10 TCCTAACAAGTCCTCTGTGTAAGCA AGGAGACACAGGGCAGTGACA 
SP-B ACGTCCTCTGGAAGCCTTCA TGTCTTCTTGGAGCCACAACAG 
SP-C ACCCTGTGTGGAGAGCTACCA TTTGCGGAGGGTCTTTCCT 
napsinABI catalog # Mm00492829ABI catalog # Mm00492829
β-actin CAGAAGGAGATTACTGCTCT GGACCACCGATCCACACA 
Gata6 TGTATTGCTCCAAATCATGTGCTT CTCTCCACGAACGCTTGTGA 
Nkx2.1 TCCAGCCTATCCCATCTGAACT CAAGCGCATCTCACGTCTCA 
Bmp4 CGAGCCAACACTGTGAGGAG TATACGGTGGAAGCCCTGTTC 
Wnt7b GCATCCAAGGTCAACGCAAT CTCAGAGTCTCATGGTCCCTTTG 
napsinABI catalog # Mm00492829ABI catalog # Mm00492829
β-actin CAGAAGGAGATTACTGCTCT GGACCACCGATCCACACA 
Gata6 TGTATTGCTCCAAATCATGTGCTT CTCTCCACGAACGCTTGTGA 
Nkx2.1 TCCAGCCTATCCCATCTGAACT CAAGCGCATCTCACGTCTCA 
Bmp4 CGAGCCAACACTGTGAGGAG TATACGGTGGAAGCCCTGTTC 
Wnt7b GCATCCAAGGTCAACGCAAT CTCAGAGTCTCATGGTCCCTTTG 
Close Modal

or Create an Account

Close Modal
Close Modal