Skip to Main Content
Table 1.

Gene identities, abbreviations, accession numbers and qRT-PCR primer sequences

Gene identity (abbreviation)Accession no.Forward primer (5′-3′)Reverse primer (5′-3′)
Ligand-binding proteins    
1. Hexamerin-1 (Hex-1) AY572858 GATCCATTCCACAAGCACG ACATTCTCCACCGTCACTCC 
2. Hexamerin-2 (Hex-2) AY572859 ACGGAAGACGTTGGACTCAG GAGGACCTGCTGGATCTTGT 
Cuticle and muscle proteins    
3. Larval Cuticle Protein A3A-like (LCP) DN792534 CGTCGACACCGACTACGAC GGTCAGCGGTGTACTCGAC 
4. Rf1 Troponin-1 [wup-like] (Trop-1) CB518302 CGACCTAGAATACGAAGTGG TTCTTCTCCTTGTCCTCCTCC 
5. Rf2 Troponin-1 [wap-like] (Trop-2) CB518303 GAAGAGTTGAAGAAGGAGCAGG TTGTTCACCAGGCTATTCAGG 
Transcription and translation factors    
6. nanos BQ788190 CCACTGACTAAATGTATGGG TTCAAGCCTCAACACTCTGT 
7. COP9 Complex Homolog Subunit 5 (COP9) DN792518 CTCGATCAGGAGGCACACTC TTGCTGCCTCAATGTATGCT 
8. BTB-POZ [broad-like] AY258590 CTGGACCAGCATCTACATCTTC GGTTGAAGCCTGATTCACAAG 
9. 18S rRNA-like (18S) AY572860 TATCGATCCTTTTGGCTTGG TCGCAATGATAGGAAGAGCC 
10. 28S rRNA-like (28S) CK906357 GCGAATGATTAGAGGCCTTG ACAGCGCCAGTTCTGCTTAC 
11. bicaudal (bic) AY258589 GAGGCAAGTACGGATTGGAG CTCTTCATGGTAACAACCAG 
12. LIM CB518301 GTGCTTCAAGTGTGGCATGT GTCCATGCTGAGACAACCAG 
Signal transduction factors    
13. Malonyl Co-A Decarboxylase (M-CoA) AY572861 GCTACCGGCGACTCTTAATC GAGGACACGCTGATTCCTTC 
14. Phospho-Inositol Phosphate (PIP) Kinase CK906365 AATTCTGCTGCCTTCTCTGG ACCTTGCTTGGTCAACCATC 
15. Apoptosis Inhibitor (Apop) CK906364 CGTACATGTGTGAGCAGGTG ATCACCATCAGGTGGCAGAG 
16. AMP Deaminase (AMP-de) CK906363 GTGACATGTGTGAGCTTGCC ACCAGCTACACCTTCCTTGG 
17. GTPase Activating Protein (GAP) BQ788178 TTCCAACAGCACAAGAGCAC TAACTGGTTGCGACAGGCAC 
18. ATPase BQ788171 TCAGGAAGTCTTGGATTCGG TACGAACTCTGGTGCGTCTG 
19. SH3 Domain Kinase (SH3) CB518513 CGTGTTGCCAATGAGTTGAG ACAATCCTATTCGGCCATCC 
Reference/control genes    
20. β-actin DQ206832 AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT 
21. NADH-dh BQ788175 GCTGGGGGTGTTATTCATTCCTA GGCATACCACAAAGAGCAAAA 
22. HSP-70 BQ788164 AGAACCAAGTGGCCATGAAC CCAATGCTTCATGTCTGCC 
Gene identity (abbreviation)Accession no.Forward primer (5′-3′)Reverse primer (5′-3′)
Ligand-binding proteins    
1. Hexamerin-1 (Hex-1) AY572858 GATCCATTCCACAAGCACG ACATTCTCCACCGTCACTCC 
2. Hexamerin-2 (Hex-2) AY572859 ACGGAAGACGTTGGACTCAG GAGGACCTGCTGGATCTTGT 
Cuticle and muscle proteins    
3. Larval Cuticle Protein A3A-like (LCP) DN792534 CGTCGACACCGACTACGAC GGTCAGCGGTGTACTCGAC 
4. Rf1 Troponin-1 [wup-like] (Trop-1) CB518302 CGACCTAGAATACGAAGTGG TTCTTCTCCTTGTCCTCCTCC 
5. Rf2 Troponin-1 [wap-like] (Trop-2) CB518303 GAAGAGTTGAAGAAGGAGCAGG TTGTTCACCAGGCTATTCAGG 
Transcription and translation factors    
6. nanos BQ788190 CCACTGACTAAATGTATGGG TTCAAGCCTCAACACTCTGT 
7. COP9 Complex Homolog Subunit 5 (COP9) DN792518 CTCGATCAGGAGGCACACTC TTGCTGCCTCAATGTATGCT 
8. BTB-POZ [broad-like] AY258590 CTGGACCAGCATCTACATCTTC GGTTGAAGCCTGATTCACAAG 
9. 18S rRNA-like (18S) AY572860 TATCGATCCTTTTGGCTTGG TCGCAATGATAGGAAGAGCC 
10. 28S rRNA-like (28S) CK906357 GCGAATGATTAGAGGCCTTG ACAGCGCCAGTTCTGCTTAC 
11. bicaudal (bic) AY258589 GAGGCAAGTACGGATTGGAG CTCTTCATGGTAACAACCAG 
12. LIM CB518301 GTGCTTCAAGTGTGGCATGT GTCCATGCTGAGACAACCAG 
Signal transduction factors    
13. Malonyl Co-A Decarboxylase (M-CoA) AY572861 GCTACCGGCGACTCTTAATC GAGGACACGCTGATTCCTTC 
14. Phospho-Inositol Phosphate (PIP) Kinase CK906365 AATTCTGCTGCCTTCTCTGG ACCTTGCTTGGTCAACCATC 
15. Apoptosis Inhibitor (Apop) CK906364 CGTACATGTGTGAGCAGGTG ATCACCATCAGGTGGCAGAG 
16. AMP Deaminase (AMP-de) CK906363 GTGACATGTGTGAGCTTGCC ACCAGCTACACCTTCCTTGG 
17. GTPase Activating Protein (GAP) BQ788178 TTCCAACAGCACAAGAGCAC TAACTGGTTGCGACAGGCAC 
18. ATPase BQ788171 TCAGGAAGTCTTGGATTCGG TACGAACTCTGGTGCGTCTG 
19. SH3 Domain Kinase (SH3) CB518513 CGTGTTGCCAATGAGTTGAG ACAATCCTATTCGGCCATCC 
Reference/control genes    
20. β-actin DQ206832 AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT 
21. NADH-dh BQ788175 GCTGGGGGTGTTATTCATTCCTA GGCATACCACAAAGAGCAAAA 
22. HSP-70 BQ788164 AGAACCAAGTGGCCATGAAC CCAATGCTTCATGTCTGCC 
Close Modal

or Create an Account

Close Modal
Close Modal