Skip to Main Content
Table 1.

RT-PCR primer sequence information

PrimerPrimer pair sequence (5′-3′)Annealing temperature (°C)Product size (bp)
beta-actin GTGGGGCGCCCCAGGCACCA 50 520 
 CTCCTTAATGTCACGCACGATTTC   
endoglin GGTGTTCCTGGTCCTCGTTT 54 640 
 CAAAGGAGGTGACAATGCTGG   
brachyury TCCAGGTGCTATATATTGCC 50 947 
 TGCTGCCTGTGAGTCATAAC   
Tie-2 ATGGACTCTTTAGCCGGCTTA 55 337 
 CCTTATAGCCTGTCCTCGAA   
PrimerPrimer pair sequence (5′-3′)Annealing temperature (°C)Product size (bp)
beta-actin GTGGGGCGCCCCAGGCACCA 50 520 
 CTCCTTAATGTCACGCACGATTTC   
endoglin GGTGTTCCTGGTCCTCGTTT 54 640 
 CAAAGGAGGTGACAATGCTGG   
brachyury TCCAGGTGCTATATATTGCC 50 947 
 TGCTGCCTGTGAGTCATAAC   
Tie-2 ATGGACTCTTTAGCCGGCTTA 55 337 
 CCTTATAGCCTGTCCTCGAA   
Close Modal

or Create an Account

Close Modal
Close Modal