Skip to Main Content
Table 1.

Primers and conditions for reverse transcriptase PCR

GeneForward primerReverse primerProduct (bp)Annealing temp. °CCycles
Oct4 GGCGTTCTCTTTGGAAAGGTGTTC CTCGAACCACATCCTTCTCT 313 55 25 
Nanog ATGAAGTGCAAGCGGTGGCAGAAA CCTGATGGAGTCACAGAGTAGTTC 440 65 26 
Fgf5 ACCCTTTGAGCTTTCTACCC CCGTCTGTGGTTTCTGTTGAGG 188 58 35 
Rex1 AGGCCAGTCCAGAATACCAG GGAACTCGCTTCCAGAACCT 233 58 30 
brachyury GTGACTGCCTACCAGAATGA ATTGTCCGCATAGGTTGGAG 336 57 33 
Id1 TCCGCCTGTTCTCAGGATCA GTAGCAGCCGTTCATGTCGT 217 55 30 
Id3 CGACATGAACCACTGCTACT CTCCTCTTGTCCTTGGAGAT 221 55 30 
β-actin (Actb) GGCCCAGAGCAAGAGAGGTATCC ACGCACGATTTCCCTCTCAGC 460 55 25 
GeneForward primerReverse primerProduct (bp)Annealing temp. °CCycles
Oct4 GGCGTTCTCTTTGGAAAGGTGTTC CTCGAACCACATCCTTCTCT 313 55 25 
Nanog ATGAAGTGCAAGCGGTGGCAGAAA CCTGATGGAGTCACAGAGTAGTTC 440 65 26 
Fgf5 ACCCTTTGAGCTTTCTACCC CCGTCTGTGGTTTCTGTTGAGG 188 58 35 
Rex1 AGGCCAGTCCAGAATACCAG GGAACTCGCTTCCAGAACCT 233 58 30 
brachyury GTGACTGCCTACCAGAATGA ATTGTCCGCATAGGTTGGAG 336 57 33 
Id1 TCCGCCTGTTCTCAGGATCA GTAGCAGCCGTTCATGTCGT 217 55 30 
Id3 CGACATGAACCACTGCTACT CTCCTCTTGTCCTTGGAGAT 221 55 30 
β-actin (Actb) GGCCCAGAGCAAGAGAGGTATCC ACGCACGATTTCCCTCTCAGC 460 55 25 

Primer sequences are shown 5′ to 3′.

Close Modal

or Create an Account

Close Modal
Close Modal