Skip to Main Content
Table 1.

Primers used in Q-PCR

GeneForward primerReverse primer
Klf4 CATTATCAAGAGCTCATGCCA GTCACAGTGGTAAGGTTTCTC 
Cldn1 GTGGAAGATTTACTCCTATGC CAG-GATGCCAATTACCATCAA 
Tgm1 GATGCCTGCCTGTACATCCT GCAGAGACAACCCGAGAGAC 
Tgm3 GCTCACGACACAGATCGAAA CGCTATCACTGCCTTTCTCC 
TAp63 CGAAAATGGTGCAACAAACA GATGGAGAGAGGGCATCAAA 
DNp63 GGAAAACAATGCCCAGACTC GATGGAGAGAGGGCATCAAA 
Cdh1 CAAGGACAGCCTTCTTTTCG TGGACTTCAGCGTCACTTTG 
Cdh3 GATTTTGAGGCTCAGGACCA GACCTTGGAAGGTGGAACAA 
Lor TCCTCTCAGCAGACCAGTCA CACCTCCACAGCTACCACCT 
Flg GGGAGGCAAGCTACAACAAC CCTGCCTCCTTCAGAGTCAC 
Ixl TATGGCAGGGGATCAGAAAG GGGTCAGGTGACTCCTGGTA 
Hprt GTAATGATCAGTCAACGGGGGAC CCAGCAAGCTTGCAACCTTAACCA 
Hbegf GACCCATGCCTCAGGAAATA TGAGAAGTCCCACGATGACA 
Ahf AACAAGAGCTCCGTCAGGAA CAGCTGCTCTTCCTCCAGTC 
Msx2 CATCCCAGCTTCTAGCCTTG GCAGCCATTTTCAGCTTTTC 
Lrrc15 GCTGACGAATCTCCGAGAAC CATGAGACCATTGACGTTGG 
Gjb2 ATGCTACGACCACCACTTCC TACGGACCTTCTGGGTTTTG 
Rxra GTCGAGCCCAAGACTGAGAC TCTAGGGGCAGCTCAGAAAA 
Rxrb CTGCAAGGGTTTCTTCAAGC ATCCTGTCCACAGGCATCTC 
Sfrp4 ACCCTGGCAACATACCTGAG ATCATCCTTGAACGCCACTC 
Sfrp2 ACGACAACGACATCATGGAA CAGCACGGATTTCTTCAGGT 
Dab2 CGCTTTCACTGGCTTAGACC GTAACTGGAGAAGGCGCTTG 
β-actin CTTCCTCCCTGGAGAAGAGC AAGGAAGGCTGGAAAAGAGC 
Scf TCCGAAGAGGCCAGAAACTA TCAGATGCCACCATAAAGTCC 
Edn1 ACTTCTGCCACCTGGACATC GTCTTTCAAGGAACGCTTGG 
Edn3 ACACGCTTGCGTTGTACTTG TTTCTGCTCTCCCGGAATAA 
Ednrb CAAAGATTGGTGGCTGTTCA GCCACTTCTCGTCTCTGCTT 
Mitf TGAAGCAAGAGCATTGGCTA TAGCTCCTTAATGCGGTCGT 
Fgf2 CGGTCACGGAAATACTCCAG TATGGCCTTCTGTCCAGGTC 
Pomc GTACCCCAACGTTGCTGAGA GACCTGCTCCAAGCCTAATG 
Mc1r ACTCCAATGCCACCTCTCAC AGCCCTAGGCTGAGGAAGAG 
Dct AACAACCCTTCCACAGATGC TAGTCACCGGTGGGAAGAAG 
Tyr TTACTCAGCCCAGCATCCTT TCAGGTGTTCCATCGCATAA 
Trp1 TCTGGCCTCCAGTTACCAAC GGCTTCATTCTTGGTGCTTC 
GeneForward primerReverse primer
Klf4 CATTATCAAGAGCTCATGCCA GTCACAGTGGTAAGGTTTCTC 
Cldn1 GTGGAAGATTTACTCCTATGC CAG-GATGCCAATTACCATCAA 
Tgm1 GATGCCTGCCTGTACATCCT GCAGAGACAACCCGAGAGAC 
Tgm3 GCTCACGACACAGATCGAAA CGCTATCACTGCCTTTCTCC 
TAp63 CGAAAATGGTGCAACAAACA GATGGAGAGAGGGCATCAAA 
DNp63 GGAAAACAATGCCCAGACTC GATGGAGAGAGGGCATCAAA 
Cdh1 CAAGGACAGCCTTCTTTTCG TGGACTTCAGCGTCACTTTG 
Cdh3 GATTTTGAGGCTCAGGACCA GACCTTGGAAGGTGGAACAA 
Lor TCCTCTCAGCAGACCAGTCA CACCTCCACAGCTACCACCT 
Flg GGGAGGCAAGCTACAACAAC CCTGCCTCCTTCAGAGTCAC 
Ixl TATGGCAGGGGATCAGAAAG GGGTCAGGTGACTCCTGGTA 
Hprt GTAATGATCAGTCAACGGGGGAC CCAGCAAGCTTGCAACCTTAACCA 
Hbegf GACCCATGCCTCAGGAAATA TGAGAAGTCCCACGATGACA 
Ahf AACAAGAGCTCCGTCAGGAA CAGCTGCTCTTCCTCCAGTC 
Msx2 CATCCCAGCTTCTAGCCTTG GCAGCCATTTTCAGCTTTTC 
Lrrc15 GCTGACGAATCTCCGAGAAC CATGAGACCATTGACGTTGG 
Gjb2 ATGCTACGACCACCACTTCC TACGGACCTTCTGGGTTTTG 
Rxra GTCGAGCCCAAGACTGAGAC TCTAGGGGCAGCTCAGAAAA 
Rxrb CTGCAAGGGTTTCTTCAAGC ATCCTGTCCACAGGCATCTC 
Sfrp4 ACCCTGGCAACATACCTGAG ATCATCCTTGAACGCCACTC 
Sfrp2 ACGACAACGACATCATGGAA CAGCACGGATTTCTTCAGGT 
Dab2 CGCTTTCACTGGCTTAGACC GTAACTGGAGAAGGCGCTTG 
β-actin CTTCCTCCCTGGAGAAGAGC AAGGAAGGCTGGAAAAGAGC 
Scf TCCGAAGAGGCCAGAAACTA TCAGATGCCACCATAAAGTCC 
Edn1 ACTTCTGCCACCTGGACATC GTCTTTCAAGGAACGCTTGG 
Edn3 ACACGCTTGCGTTGTACTTG TTTCTGCTCTCCCGGAATAA 
Ednrb CAAAGATTGGTGGCTGTTCA GCCACTTCTCGTCTCTGCTT 
Mitf TGAAGCAAGAGCATTGGCTA TAGCTCCTTAATGCGGTCGT 
Fgf2 CGGTCACGGAAATACTCCAG TATGGCCTTCTGTCCAGGTC 
Pomc GTACCCCAACGTTGCTGAGA GACCTGCTCCAAGCCTAATG 
Mc1r ACTCCAATGCCACCTCTCAC AGCCCTAGGCTGAGGAAGAG 
Dct AACAACCCTTCCACAGATGC TAGTCACCGGTGGGAAGAAG 
Tyr TTACTCAGCCCAGCATCCTT TCAGGTGTTCCATCGCATAA 
Trp1 TCTGGCCTCCAGTTACCAAC GGCTTCATTCTTGGTGCTTC 

Sequences are shown 5′ to 3′.

Close Modal

or Create an Account

Close Modal
Close Modal