Genotyping of Scx alleles
| PCR . | Forward primer (5′-3′) . | Reverse primer (5′-3′) . | PCR conditions . | Product . |
|---|---|---|---|---|
| ScxNull | Scx5′gen: CACACGGCCTGGCACAAAAGACC | Scxint1rev: GAGGGGTAGTGGCACATCAGC | 40×(94°C, 1 min; 62°C, 1 min; 72°C, 1 min) | 578 bp |
| Scxflox | Scx5′UTRA: TGGCGGCCCCACTCCAGTCC | ScxExon1rev: AAGCCCGTGTTCACGCTGTTGG | 40×(94°C, 1 min; 63°C, 1 min; 72°C, 1 min) add 10% DMSO | 485 bp |
| ScxWT | Scx5′UTRA: TGGCGGCCCCACTCCAGTCC | ScxExon1rev: AAGCCCGTGTTCACGCTGTTGG | 40×(94°C, 1 min; 63°C, 1 min; 72°C, 1 min) add 10% DMSO | 451 bp |
| PCR . | Forward primer (5′-3′) . | Reverse primer (5′-3′) . | PCR conditions . | Product . |
|---|---|---|---|---|
| ScxNull | Scx5′gen: CACACGGCCTGGCACAAAAGACC | Scxint1rev: GAGGGGTAGTGGCACATCAGC | 40×(94°C, 1 min; 62°C, 1 min; 72°C, 1 min) | 578 bp |
| Scxflox | Scx5′UTRA: TGGCGGCCCCACTCCAGTCC | ScxExon1rev: AAGCCCGTGTTCACGCTGTTGG | 40×(94°C, 1 min; 63°C, 1 min; 72°C, 1 min) add 10% DMSO | 485 bp |
| ScxWT | Scx5′UTRA: TGGCGGCCCCACTCCAGTCC | ScxExon1rev: AAGCCCGTGTTCACGCTGTTGG | 40×(94°C, 1 min; 63°C, 1 min; 72°C, 1 min) add 10% DMSO | 451 bp |
The ScxNull PCR extends across the sequences of the first exon of Scx missing in the Scx− allele. The Scxflox and ScxWT PCRs both make use of the same primer set and generate a product that spans the 5′ loxP site in the Scxflox allele. In a heterozygous mouse, Scxflox/+, this PCR reaction would therefore result in two bands representing both the wild-type and Scxflox alleles.