Skip to Main Content
Table 1.

Genotyping of Scx alleles

PCRForward primer (5′-3′)Reverse primer (5′-3′)PCR conditionsProduct
ScxNull Scx5′gen: CACACGGCCTGGCACAAAAGACC Scxint1rev: GAGGGGTAGTGGCACATCAGC 40×(94°C, 1 min; 62°C, 1 min; 72°C, 1 min) 578 bp 
Scxflox Scx5′UTRA: TGGCGGCCCCACTCCAGTCC ScxExon1rev: AAGCCCGTGTTCACGCTGTTGG 40×(94°C, 1 min; 63°C, 1 min; 72°C, 1 min) add 10% DMSO 485 bp 
ScxWT Scx5′UTRA: TGGCGGCCCCACTCCAGTCC ScxExon1rev: AAGCCCGTGTTCACGCTGTTGG 40×(94°C, 1 min; 63°C, 1 min; 72°C, 1 min) add 10% DMSO 451 bp 
PCRForward primer (5′-3′)Reverse primer (5′-3′)PCR conditionsProduct
ScxNull Scx5′gen: CACACGGCCTGGCACAAAAGACC Scxint1rev: GAGGGGTAGTGGCACATCAGC 40×(94°C, 1 min; 62°C, 1 min; 72°C, 1 min) 578 bp 
Scxflox Scx5′UTRA: TGGCGGCCCCACTCCAGTCC ScxExon1rev: AAGCCCGTGTTCACGCTGTTGG 40×(94°C, 1 min; 63°C, 1 min; 72°C, 1 min) add 10% DMSO 485 bp 
ScxWT Scx5′UTRA: TGGCGGCCCCACTCCAGTCC ScxExon1rev: AAGCCCGTGTTCACGCTGTTGG 40×(94°C, 1 min; 63°C, 1 min; 72°C, 1 min) add 10% DMSO 451 bp 

The ScxNull PCR extends across the sequences of the first exon of Scx missing in the Scx allele. The Scxflox and ScxWT PCRs both make use of the same primer set and generate a product that spans the 5′ loxP site in the Scxflox allele. In a heterozygous mouse, Scxflox/+, this PCR reaction would therefore result in two bands representing both the wild-type and Scxflox alleles.

Close Modal

or Create an Account

Close Modal
Close Modal