Skip to Main Content
Table 2.

PCR primers used in this study

PrimerForwardReversePositions*
Hoxb8 proximal aacaggagacagagaaactggtac actgtttgctttgctgctgtttag 1-516 
 gggtataaatttctgaaggttaag agggatgagaagggccgaggg 446-1006 
 tatgactacctcgttgtttg caaagactgatgtgggggagt 4292-4565 
 ggtgtttttccgtgactcccccac tagaacagcgaagcctgcaaaagt 4531-5091 
 gccgcggctgccatgcaggcttag cacggcgcacgggttctgctggta 5045-5568 
 ttctacggctacgaccctctgcag cttgagggcgcatccaggg 5593-5764 
 ccctggatgcgccctcaag tctccacagcccccataaaac 5746-6083 
 actgttttatgggggctgtggaga tctctggtaactagaaccag 6060-6315 
 tggagctggagaaggagttccta cagaagctattacgagatactacc 6592-7041 
 10 ctccttcccttctcttgggggtcc caatgctcacagcgcgcatgc 7061-7529 
 11 ttagcatgcgcgctgtgagcattg cactagccaccagcctgggta 7560-8032 
 12 cgctcttgggaagagatctaccca cccaagaggaggcgagcctgg 7994-8584 
 13 aggccaggctcgcctcctcttggg agtcggggacgttttagtgtc 8561-9085 
 14 tcacgtggtcagaagagg ctgagcttcgcatccaggggta 8978-9505 
 15 tacccctggatgcgaagctcag ctagggcctgagagcactgagc 9484-9706 
 16 gctcagtgctctcaggccctag acacccagaactgagctctc 9685-9927 
 17 gagagctcagttctgggtgt accactctttgactctgtgt 9908-10134 
 18 acacagagtcaaagagtggt gtcatctttctggagtgata 10115-10323 
 19 tatcactccagaaagatgac atgagtataggagtctct 10304-10527 
 20 agagactcctatactcat tctgagaactcccagcata 10501-10792 
 21 tatgctgggagttctcaga ctgacagaacttggctctgatg 10774-10985 
 22 catcagagccaagttctgtcag ctgtcatcagtcactctct 10964-11218 
 23 agagagtgactgatgacag agccatcctcctgattcag 11220-11408 
 24 ctgcacctagtagtg tgtaggtctggcggcctcgcttt 11581-11787 
 25 ttgtaagccctctttgaagct taacataaccctcctggcaggccg 12309-12829 
Hoxb8 distal D1 ggtagtagctttctgatggt aggatgcaaactccattata  
 D2 accatcagaaagctactacc aacgaatttattgagaattc  
Hoxb3  atgcagaaagccacctacta ttggacgtttgcctcgactc  
Hoxb6  atgagttcctatttcgtgaa accagccggcggcggctacg  
Hoxb8  atgagctcttatttcgtcaa gcttgcagtctgcgtactgc  
Hoxb9  atgtccatttctgggacgct tggtagacagacggcaggct  
Hoxa4  agctccagccctggcttcgc cgtgatggatgcygctagcc  
Adam34  atgagtgggactaaggccctg gcggttatgatctattactac  
PrimerForwardReversePositions*
Hoxb8 proximal aacaggagacagagaaactggtac actgtttgctttgctgctgtttag 1-516 
 gggtataaatttctgaaggttaag agggatgagaagggccgaggg 446-1006 
 tatgactacctcgttgtttg caaagactgatgtgggggagt 4292-4565 
 ggtgtttttccgtgactcccccac tagaacagcgaagcctgcaaaagt 4531-5091 
 gccgcggctgccatgcaggcttag cacggcgcacgggttctgctggta 5045-5568 
 ttctacggctacgaccctctgcag cttgagggcgcatccaggg 5593-5764 
 ccctggatgcgccctcaag tctccacagcccccataaaac 5746-6083 
 actgttttatgggggctgtggaga tctctggtaactagaaccag 6060-6315 
 tggagctggagaaggagttccta cagaagctattacgagatactacc 6592-7041 
 10 ctccttcccttctcttgggggtcc caatgctcacagcgcgcatgc 7061-7529 
 11 ttagcatgcgcgctgtgagcattg cactagccaccagcctgggta 7560-8032 
 12 cgctcttgggaagagatctaccca cccaagaggaggcgagcctgg 7994-8584 
 13 aggccaggctcgcctcctcttggg agtcggggacgttttagtgtc 8561-9085 
 14 tcacgtggtcagaagagg ctgagcttcgcatccaggggta 8978-9505 
 15 tacccctggatgcgaagctcag ctagggcctgagagcactgagc 9484-9706 
 16 gctcagtgctctcaggccctag acacccagaactgagctctc 9685-9927 
 17 gagagctcagttctgggtgt accactctttgactctgtgt 9908-10134 
 18 acacagagtcaaagagtggt gtcatctttctggagtgata 10115-10323 
 19 tatcactccagaaagatgac atgagtataggagtctct 10304-10527 
 20 agagactcctatactcat tctgagaactcccagcata 10501-10792 
 21 tatgctgggagttctcaga ctgacagaacttggctctgatg 10774-10985 
 22 catcagagccaagttctgtcag ctgtcatcagtcactctct 10964-11218 
 23 agagagtgactgatgacag agccatcctcctgattcag 11220-11408 
 24 ctgcacctagtagtg tgtaggtctggcggcctcgcttt 11581-11787 
 25 ttgtaagccctctttgaagct taacataaccctcctggcaggccg 12309-12829 
Hoxb8 distal D1 ggtagtagctttctgatggt aggatgcaaactccattata  
 D2 accatcagaaagctactacc aacgaatttattgagaattc  
Hoxb3  atgcagaaagccacctacta ttggacgtttgcctcgactc  
Hoxb6  atgagttcctatttcgtgaa accagccggcggcggctacg  
Hoxb8  atgagctcttatttcgtcaa gcttgcagtctgcgtactgc  
Hoxb9  atgtccatttctgggacgct tggtagacagacggcaggct  
Hoxa4  agctccagccctggcttcgc cgtgatggatgcygctagcc  
Adam34  atgagtgggactaaggccctg gcggttatgatctattactac  
*

Position of 5′-most nucleotide of region 1 was arbitrarily designated as `1'

Close Modal

or Create an Account

Close Modal
Close Modal