Skip to Main Content
Table 1.

The sequences for siRNA targeting

NameSequence (5′-3′)Position (in coding sequence)GenBank Accession Number
Control AATTCTCCGAACGTGTCACGT – Random sequence 
Alk2 AACGTCGGAGATAGCACTCTA 519∼539 NM_024486 
Alk3 AACCGTGACTTGGAACAGGAT 567∼587 NM_030849 
Smad1 AACCGGAACTCCACTATTGAA 361∼381 AF067727 
Smad5 AATGCCACGTTTCCTGATTCC 508∼528 AB010955 
Smad8 AACACCAGAAGGCACATTGGA 867∼887 AF012347 
NameSequence (5′-3′)Position (in coding sequence)GenBank Accession Number
Control AATTCTCCGAACGTGTCACGT – Random sequence 
Alk2 AACGTCGGAGATAGCACTCTA 519∼539 NM_024486 
Alk3 AACCGTGACTTGGAACAGGAT 567∼587 NM_030849 
Smad1 AACCGGAACTCCACTATTGAA 361∼381 AF067727 
Smad5 AATGCCACGTTTCCTGATTCC 508∼528 AB010955 
Smad8 AACACCAGAAGGCACATTGGA 867∼887 AF012347 
Close Modal

or Create an Account

Close Modal
Close Modal