Sequences of 28-mer cDNAs used in competition experiments to validate in situ hybridisation probe specificity
| Name . | cDNA sequence (5′-3′) . | Region in mRNA (base no.'s) . | Identity with probe sequence . | Reference (species/acc. number) . |
|---|---|---|---|---|
| α1b sequence in α1a probe region | ACAGTGTTCATTGGATGTAATGATAAGG | 3328-3354 | 14/28 | O. mykiss/AY319390 |
| α1a sequence in α1b probe region | AGAGTTAGACACACAGTTACAGTAGCCA | 1055-1082 | 14/28 | O. mykiss/AY319391 |
| Name . | cDNA sequence (5′-3′) . | Region in mRNA (base no.'s) . | Identity with probe sequence . | Reference (species/acc. number) . |
|---|---|---|---|---|
| α1b sequence in α1a probe region | ACAGTGTTCATTGGATGTAATGATAAGG | 3328-3354 | 14/28 | O. mykiss/AY319390 |
| α1a sequence in α1b probe region | AGAGTTAGACACACAGTTACAGTAGCCA | 1055-1082 | 14/28 | O. mykiss/AY319391 |
The listed sequences were used in 10-fold excess in conjunction with the cross-matching isoform AP-conjugated in situ hybridisation (ISH)probe: i.e. α1b sequence was combined withα 1a probe and vice versa