Skip to Main Content
Table 1.

List of primer pairs used to amplify FoxK1 from Takifugu rubripes

Primer pairForward primer (5′→3′)Reverse primer (5′→3′)Amplicon size (bp)
cDNA-FoxK1 GGACGACACTGGAGCAAGA GGGGCTCATTTTTGATCAAG 1676 
ISH-FoxK1-α GAGTCCAAGCCACCTTATTC GGGGCTCATTTTTGATCAAG 823 
ISH-FoxK1-γ GAGTCCAAGCCACCTTATTC CTGGAGCGCTCTGGGAGTAC 703 
ISH-FoxK1-δ GAGTCCAAGCCACCTTATTC CTGGAGCGCTCTGGGAGTAC 940 
qPCR-FoxK1-α GCTGGCAGAACTCCATCAGACAC TCGCTGCCGCCTTTTCCTG 158 
qPCR-FoxK1-γ CAGAACTCCATCAGACACAACC CAGGGGCGCTTCTGGAGG 208 
qPCR-FoxK1-δ CGTGACTCTGCCGGACTCTG CTGACCAAGTAGCACAGCAAGATC 174 
Primer pairForward primer (5′→3′)Reverse primer (5′→3′)Amplicon size (bp)
cDNA-FoxK1 GGACGACACTGGAGCAAGA GGGGCTCATTTTTGATCAAG 1676 
ISH-FoxK1-α GAGTCCAAGCCACCTTATTC GGGGCTCATTTTTGATCAAG 823 
ISH-FoxK1-γ GAGTCCAAGCCACCTTATTC CTGGAGCGCTCTGGGAGTAC 703 
ISH-FoxK1-δ GAGTCCAAGCCACCTTATTC CTGGAGCGCTCTGGGAGTAC 940 
qPCR-FoxK1-α GCTGGCAGAACTCCATCAGACAC TCGCTGCCGCCTTTTCCTG 158 
qPCR-FoxK1-γ CAGAACTCCATCAGACACAACC CAGGGGCGCTTCTGGAGG 208 
qPCR-FoxK1-δ CGTGACTCTGCCGGACTCTG CTGACCAAGTAGCACAGCAAGATC 174 

cDNA-FoxK1: sequences of the primers used to initially amplify the T. rubripes orthologue of FoxK1. ISH primer pairs: sequences used to subclone the three TFoxK1 splice variants for in situhybridisation. qPCR primer pairs: sequences used to quantify expression of the alternative TFoxK1 transcripts by real-time PCR

Close Modal

or Create an Account

Close Modal
Close Modal