Skip to Main Content
Table 1.

Primer and probe sequences for detection of glutamine synthetase(Onmy-GS01–GS04) and β-actin gene expression in rainbow trout Oncorhynchus mykiss using real time PCR

Gene*Forward primer 5′–3′Reverse primer 5′–3′Probe 5′–3′Length of amplicon (bp)
Onmy-GS01 CTGCAGTCTGTGTTCAGGGTAGA CATCTGTCTGGAATTGTTAAGTCCATA TACCTTTTGATCACTGCCAACATTGCCC 101 
Onmy-GS02 GGCAGTGTCTTTAAATGGCAACA ACGCTACAATTGGCAAGACTGA CTGTCTCCAGATTTGACACATTCCTGGATCAT 136 
Onmy-GS03 GTGTATCAATTTGCTACTCATGTTTAACAT AAAATGGGTTCTTGATACAACTTCTACTAA AAGGATCCAAGGTGCATCTGTGTTTTTATACATG 191 
Onmy-GS04 TTAATGAAAGATGGTGGCTGACA CTGCAGGAAACGCGAGATC CATTGTCTTCCCCTTTTGAGTCTTCTAGTGGG 105 
β-actin GACCCAGATCATGTTTGAGACCTT CGTAGCCCTCGTAGATGGGTACT ACTCCGGTGACGGCGTGACCC 152 
Gene*Forward primer 5′–3′Reverse primer 5′–3′Probe 5′–3′Length of amplicon (bp)
Onmy-GS01 CTGCAGTCTGTGTTCAGGGTAGA CATCTGTCTGGAATTGTTAAGTCCATA TACCTTTTGATCACTGCCAACATTGCCC 101 
Onmy-GS02 GGCAGTGTCTTTAAATGGCAACA ACGCTACAATTGGCAAGACTGA CTGTCTCCAGATTTGACACATTCCTGGATCAT 136 
Onmy-GS03 GTGTATCAATTTGCTACTCATGTTTAACAT AAAATGGGTTCTTGATACAACTTCTACTAA AAGGATCCAAGGTGCATCTGTGTTTTTATACATG 191 
Onmy-GS04 TTAATGAAAGATGGTGGCTGACA CTGCAGGAAACGCGAGATC CATTGTCTTCCCCTTTTGAGTCTTCTAGTGGG 105 
β-actin GACCCAGATCATGTTTGAGACCTT CGTAGCCCTCGTAGATGGGTACT ACTCCGGTGACGGCGTGACCC 152 
*

GenBank accession numbers: Onmy-GS01, AF390021; Onmy-GS02, AF390022; Onmy-GS03, AF390023; Onmy-GS04, AF390024; β-actin, AJ438158

Close Modal

or Create an Account

Close Modal
Close Modal