Skip to Main Content
Table 2.

Details of primers used for ChIP PCR analysis

Primer setxTBE gelForward sequenceReverse sequence
Kcnq1ot1 1 CTCAGTTCCACGATACCCTTCC CTTACAGAAGCAGGGGTGGTCT 
Cdkn1c 1 TTCTGTAACCGCACACACC CAAAGGCTCAGAGAGATTCAGC 
Phlda2 0.6 CTCCCTACAGAAACGCACG CCAGCAGGAACTACACAGACC 
Tssc4 0.6 AACACTTGGACCTCCACACC ACCCTTTAACCACCCAGCTT 
Ascl2 0.6 ACAGGTGTGCTCCTGCAATG GCGGTGACCAAGAGGTAGGA 
Cd81 0.6 GAGGTCTATAAAGAGTGAGGAGC CTTGGATTGGTCCTGGAG 
Osbpl5 0.6 CCCTAAAGAAAGTGAAGC AATAGTCCACTGACCAGC 
Primer setxTBE gelForward sequenceReverse sequence
Kcnq1ot1 1 CTCAGTTCCACGATACCCTTCC CTTACAGAAGCAGGGGTGGTCT 
Cdkn1c 1 TTCTGTAACCGCACACACC CAAAGGCTCAGAGAGATTCAGC 
Phlda2 0.6 CTCCCTACAGAAACGCACG CCAGCAGGAACTACACAGACC 
Tssc4 0.6 AACACTTGGACCTCCACACC ACCCTTTAACCACCCAGCTT 
Ascl2 0.6 ACAGGTGTGCTCCTGCAATG GCGGTGACCAAGAGGTAGGA 
Cd81 0.6 GAGGTCTATAAAGAGTGAGGAGC CTTGGATTGGTCCTGGAG 
Osbpl5 0.6 CCCTAAAGAAAGTGAAGC AATAGTCCACTGACCAGC 
Close Modal

or Create an Account

Close Modal
Close Modal