Skip to Main Content
Table 1.

Details of primers used for RT-PCR analysis

GenePrimersPCR conditionsPolymorphismGel conditionsCross
Osbpl5 F: CCACCATCCCAGATCAAGAC 58°C Nco10% polyacrylamide B6/Cast 
 R: TTCTCCTGTGTGGCTTTGTG     
Phlda2 F: CGTGATGTCTTCGAAAACCG 57°C Deletion 0.6×TBE, 0.5×MDE SSCP B6/Cast 
 R: TGACGATGGTGAAGTACACG     
Cdkn1c (C) F: GCCAAGCGCAAGAGAACT 57°C Taq1% agarose B6/Cast 
 R: CAACAACCATTCCCCTAGAGTC     
Cdkn1c (S) F: TTCAGATCTGACCTCAGACCC 58°C Ava10% polyacrylamide B6/SD7 
 R: GACCGGCTCAGTTCCCAGCTCAT     
Kcnq1ot1(C) F: CTGAATTGGGGGAATAGCA 57°C Stu1% agarose B6/Cast 
 R: CCATTTCTGCACCTGTTTT     
Kcnq1ot1(S) F: TTGCCTGAGGATGGCTGTG 57°C Mwo1% agarose B6/SD7 
 R: CTTTCCGCTGTAACCTTTCTG     
Tssc4 F: AGAAGCTGCCCATCCTGAGT 59°C Alu10% polyacrylamide B6/Cast B6/SD7 
 R: GACCCACAATTCCCACAGTC     
Cd81(C) F: GCGTCCTTGCTTCAAAGAGA 58°C Fau1% agarose B6/Cast 
 R: AGGCAAACAGGATCACAAGG     
Cd81(S) F: GGGGACATGGCCTGTGTAT 58°C Deletion 10% polyacrylamide B6/SD7 
 R: GCTCCCAAAAGGTAACAGGA     
Ascl2 F: TGAGCATCCCACCCCCCTA 55°C Sfc1% agarose B6/Cast 
 R: CCAAACATCAGCGTCAGTATAG     
GenePrimersPCR conditionsPolymorphismGel conditionsCross
Osbpl5 F: CCACCATCCCAGATCAAGAC 58°C Nco10% polyacrylamide B6/Cast 
 R: TTCTCCTGTGTGGCTTTGTG     
Phlda2 F: CGTGATGTCTTCGAAAACCG 57°C Deletion 0.6×TBE, 0.5×MDE SSCP B6/Cast 
 R: TGACGATGGTGAAGTACACG     
Cdkn1c (C) F: GCCAAGCGCAAGAGAACT 57°C Taq1% agarose B6/Cast 
 R: CAACAACCATTCCCCTAGAGTC     
Cdkn1c (S) F: TTCAGATCTGACCTCAGACCC 58°C Ava10% polyacrylamide B6/SD7 
 R: GACCGGCTCAGTTCCCAGCTCAT     
Kcnq1ot1(C) F: CTGAATTGGGGGAATAGCA 57°C Stu1% agarose B6/Cast 
 R: CCATTTCTGCACCTGTTTT     
Kcnq1ot1(S) F: TTGCCTGAGGATGGCTGTG 57°C Mwo1% agarose B6/SD7 
 R: CTTTCCGCTGTAACCTTTCTG     
Tssc4 F: AGAAGCTGCCCATCCTGAGT 59°C Alu10% polyacrylamide B6/Cast B6/SD7 
 R: GACCCACAATTCCCACAGTC     
Cd81(C) F: GCGTCCTTGCTTCAAAGAGA 58°C Fau1% agarose B6/Cast 
 R: AGGCAAACAGGATCACAAGG     
Cd81(S) F: GGGGACATGGCCTGTGTAT 58°C Deletion 10% polyacrylamide B6/SD7 
 R: GCTCCCAAAAGGTAACAGGA     
Ascl2 F: TGAGCATCCCACCCCCCTA 55°C Sfc1% agarose B6/Cast 
 R: CCAAACATCAGCGTCAGTATAG     
Close Modal

or Create an Account

Close Modal
Close Modal