Skip to Main Content
Table 1.

Sequences of gene-specific primers used for RT-PCR

GeneForward primerReverse primer
MS12 ATTGGCCACAGCTTCCTCAGA TTGGAAGACCTCTCCCTCATGG 
MS13 TGCGCCATTACATGTCCTGA TCCCCAACCCTGTTGATATCC 
MS14 ACGAAGGTTGAAAAAGCGCA CGATCAAACAACCGGACAGTG 
MS15 GGACAAAGTGGTCGACTTCCA CCGCCATATCTGCAATGTACC 
AG TCGGACAATTCTAACACCGGA CCCATCAATTGCCTGTTGG 
AP2 ATTTGGGTTTGTTCGACACC ATGACTCGGCATTGAGTTCC 
GAPDHα ATGGCTTCGGTTACTTTCTCTGTC TTCTTGGCACCAGCTTCAAT 
FAS2 GCTCTAGAATTCATGAAGGGAGGTACGATACAG GAGAGGCTACATACTTTGTTAAG 
FAS1 CTTCCCATTCTTCATCACTATCAACTTC TGTTCAGGCAATTGACAACGC 
GeneForward primerReverse primer
MS12 ATTGGCCACAGCTTCCTCAGA TTGGAAGACCTCTCCCTCATGG 
MS13 TGCGCCATTACATGTCCTGA TCCCCAACCCTGTTGATATCC 
MS14 ACGAAGGTTGAAAAAGCGCA CGATCAAACAACCGGACAGTG 
MS15 GGACAAAGTGGTCGACTTCCA CCGCCATATCTGCAATGTACC 
AG TCGGACAATTCTAACACCGGA CCCATCAATTGCCTGTTGG 
AP2 ATTTGGGTTTGTTCGACACC ATGACTCGGCATTGAGTTCC 
GAPDHα ATGGCTTCGGTTACTTTCTCTGTC TTCTTGGCACCAGCTTCAAT 
FAS2 GCTCTAGAATTCATGAAGGGAGGTACGATACAG GAGAGGCTACATACTTTGTTAAG 
FAS1 CTTCCCATTCTTCATCACTATCAACTTC TGTTCAGGCAATTGACAACGC 
Close Modal

or Create an Account

Close Modal
Close Modal