Skip to Main Content
Table 1.

PCR primers used in this study

Primer namePrimer sequence (5′-3′)Region analyzed
Mvh-F TTTGGCTCATATGATGCGGG 210 bp 
Mvh-R ACACCCTTGTACTATCTGTCGAACTGAATGACC  
Mage-b4-F ACGCGAGGTATCTCGGGC 180 bp 
Mage-b4-R GGGCGTAAGTTGGCAACC  
Dazl-F TTCTGCTCCACCTTCGAGGTT 335 bp 
Dazl-R CTATCTTCTGCACATCCCAGTCATTA  
Scp3-F CCAATCAGCAGAGAGCTTGG 450 bp 
Scp3-R AGCTGTCGCTGTCCCCACAC  
Hprt-F GCTGGTGAAAAGGACCTCT 250 bp 
Hprt-R CACAGGACTAGAACACCTGC  
B-Daz-F GGAAGAAAAAAACTAAGTCCTGATGGC 360 bp (−540 to −180) 
B-Daz-R AAACCCCCCCAATCCCTCAC  
B-Mvh-F TGAATGAATATAATGGAATTGATGAGTT 248 bp (−378 to −77) 
B-Mvh-R AAAACAACAAATAACATCAAA  
B-Scp3-F GAATGAGGATTTATGAGTAAAGATGGTT 381 bp (−241 to +141) 
B-Scp3-R CCCCCATCTCCTTAACCTCAA  
B-Tnap-F GGAAGAAAAAAACTAAGTCCTGATGGC 128 bp (−213 to −85) 
B-Tnap-B AAACCCCCCCAATCCCTCAC  
Primer namePrimer sequence (5′-3′)Region analyzed
Mvh-F TTTGGCTCATATGATGCGGG 210 bp 
Mvh-R ACACCCTTGTACTATCTGTCGAACTGAATGACC  
Mage-b4-F ACGCGAGGTATCTCGGGC 180 bp 
Mage-b4-R GGGCGTAAGTTGGCAACC  
Dazl-F TTCTGCTCCACCTTCGAGGTT 335 bp 
Dazl-R CTATCTTCTGCACATCCCAGTCATTA  
Scp3-F CCAATCAGCAGAGAGCTTGG 450 bp 
Scp3-R AGCTGTCGCTGTCCCCACAC  
Hprt-F GCTGGTGAAAAGGACCTCT 250 bp 
Hprt-R CACAGGACTAGAACACCTGC  
B-Daz-F GGAAGAAAAAAACTAAGTCCTGATGGC 360 bp (−540 to −180) 
B-Daz-R AAACCCCCCCAATCCCTCAC  
B-Mvh-F TGAATGAATATAATGGAATTGATGAGTT 248 bp (−378 to −77) 
B-Mvh-R AAAACAACAAATAACATCAAA  
B-Scp3-F GAATGAGGATTTATGAGTAAAGATGGTT 381 bp (−241 to +141) 
B-Scp3-R CCCCCATCTCCTTAACCTCAA  
B-Tnap-F GGAAGAAAAAAACTAAGTCCTGATGGC 128 bp (−213 to −85) 
B-Tnap-B AAACCCCCCCAATCCCTCAC  
Close Modal

or Create an Account

Close Modal
Close Modal