GABA receptors in the olfactory epithelium of the gilthead seabream (Sparus aurata)

Since the Industrial Revolution, the concentration of carbon dioxide (CO₂) in the atmosphere has increased. The ocean absorbs about 30% of the CO₂ released into the atmosphere; water and CO₂ combine to form carbonic acid (H₂CO₃), a weak acid that dissociates into protons (H⁺) and bicarbonate ions (HCO₃⁻) and causes a reduction in seawater pH: ocean acidification. As atmospheric CO₂ has increased from pre-industrial (280 ppm) to present day values (∼400 ppm), equilibration with the ocean has led to a corresponding pH decline of 0.1 units, with a further fall of 0.77 units predicted by the year 2300 (Doney et al., 2009). Elevated concentrations of CO₂ in seawater can disrupt sensory systems in marine fish, including olfaction (Dixson et al., 2010; Munday et al., 2010), hearing (Simpson et al., 2011) and vision (Ferrari et al., 2012b), and have also been implicated in cognitive function, such as changes in lateralization (Domenici et al., 2012) and learning (Ferrari et al., 2012a). Disruption to cognitive function suggests that ocean acidification affects not only individual sensory systems but also central neuronal processing (Wisenden, 2012). The most accepted explanation for this is the ‘GABA_A receptor theory’ (Nilsson et al., 2012); a reversal of ionic flux through neuronal γ-aminobutyric acid type A receptors (GABA_ARs), owing to alterations of [Cl⁻] and/or [HCO₃⁻], causes depolarization (i.e. excitation) rather than hyperpolarization (i.e. inhibition) (Nilsson et al., 2012). The main empirical evidence for this is that gabazine, a GABA_A receptor antagonist, reverses the effects of high CO₂ (e.g. Hamilton et al., 2014; Lai et al., 2015; Watson et al., 2014). However, an additional mechanism by which ocean acidification could affect olfactory-driven behaviour is through direct effects on the peripheral olfactory system. Acute exposure to high P_CO2/low pH water decreases olfactory nerve responses to some odorants in seabream (Velez et al., 2019) and sea bass (Porteus et al., 2018). It was proposed that increased [H⁺] may change the protonation of odorants; this, in turn, may reduce the receptor–ligand binding affinity and, thus, reduce olfactory sensitivity (Velez et al., 2019). Therefore, animals must be closer to an odorant source to detect it (Porteus et al., 2018). Although the GABA_A hypothesis can explain mal-adaptive changes in behaviour, it lacks comprehensive empirical demonstration. Furthermore, the use of gabazine has been confined to water-borne exposure, assuming that exposure to systems other than the CNS would be without effect, disregarding the possible presence of GABA_A receptors in sensory systems (Chivers et al., 2014; Chung et al., 2014; Hamilton et al., 2014). However, a subset of rat taste bud cells contains GABA and GABA transporter subtype 3, suggesting that GABAergic transmission may be modulating taste (Cao et al., 2009; Obata et al., 1997). Therefore, we investigated the possible involvement of GABAergic innervation in the peripheral olfactory system. Our aim was to evaluate the presence of GABA_A receptors in the olfactory epithelium of a marine teleost, the gilthead seabream (Sparus aurata).

Animal maintenance and experimentation were carried out in certified experimental facilities and followed Portuguese national legislation (DL 113/2013) under a ‘group-1’ licence by the Veterinary General Directorate, Ministry of Agriculture, Rural Development and Fisheries of Portugal. Gilthead seabream, Sparus aurata Linnaeus 1758 (207±32 g, 22.3±0.8 cm, means±s.e.m.), were obtained from a commercial supplier (Maresa - Mariscos de Esteros, SA, Huelva, Spain) and maintained at the experimental station of Ramalhete (University of Algarve, Portugal) in 1000 l tanks with continuously running natural seawater, under natural photoperiod and temperature and fed daily with commercial pellets (Sparos, Olhão, Portugal).

RT-qPCR was used to analyse the mRNA expression of target genes in the olfactory epithelium of seabream (n=5). Seabream were anaesthetised with phenoxy-ethanol in seawater (1:10,000), decapitated and pithed, and the olfactory epithelia disected out. Total RNA was extracted from olfactory epithelium samples fixed in RNAlater^® (Sigma-Aldrich) using the E.Z.N.A^® Total RNA Kit I (R6834, Omega) and RNA extracts were column purified and treated with DNase using the E.Z.N.A^® RNase-Free DNase Set I kit (E1091, Omega) according to the manufacturer's instructions. RNA quality and concentration were assessed with a Nanodrop 1000 spectrophotometer (ThermoFisher Scientific) and its integrity verified by electrophoresis in a 2% agarose gel. DNA-free total RNA (500 ng) was used for cDNA synthesis as previously described (Costa et al., 2017). Briefly, cDNA was synthetized in a 20 µl reaction volume containing 100 mmol l⁻¹ random hexamers (Specanalítica), 100 U of RevertAid Reverse Transcriptase (ThermoFisher Scientific), 8 U of NZY Ribonuclease Inhibitor (nzytech) and 100 mmol l⁻¹ of nucleotides (nzytech). Specific PCR primers were designed for gilthead seabream gabra1 (accession no. XM_030437596; forward: CATGACCACACTCAGTATCAG, reverse: CTTCTCTGGAACCACACTTT, 184 bp amplicon, T_a=58°C) and gabbr2 (accession no. XM_030412068; forward: GGCGGTGGTTATCAGTTT, reverse: TCTTCGTTCCCAAGTTCATC, 177 bp amplicon, T_a=60°C) transcripts using the PrimerQuest Tool (IDT Integrated DNA Technologies, https://www.idtdna.com). Duplicate 10 µl reactions of 1× SsoFast-Evagreen Supermix (BioRad) containing 5 ng cDNA and 300 nmol l⁻¹ of forward and reverse primers were used. The PCR products were sequenced and run on a 2% (w/v) agarose gel to confirm amplicon identity and size, respectively. Transcripts were quantified in a StepOnePlus thermocycler (Applied Biosystems) using the standard-curve method (software StepOne™ Real Time) as previously described (Costa et al., 2017). The standard curve was generated using serial dilutions of specific PCR products for each gene (obtained using the same species and tissue and primers as for RT-qPCR analysis). A final melting curve was performed between 60 and 95°C and produced a single product dissociation curve for each gene. Efficiencies of standard curves were 88% and 93% for gabra1 and gabbr2, respectively, with R²=1. Relative expression was estimated using the geometric mean of 18 s (Vieira et al., 2011) and ef1α (Pinto et al., 2016) expression, which did not vary significantly (P>0.05) between samples.

Seabream were anaesthetised with phenoxy-ethanol (1:10,000) in seawater, decapitated and pithed and the olfactory rosettes were dissected out and fixed in 4% paraformaldehyde and embedded in low-melting point paraffin wax (Histoseck). Serial 5 µm sections were obtained and mounted on poly-l-lysine (Sigma-Aldrich) coated glass slides. To visualize the presence of GABA_A receptors in the olfactory epithelium, dewaxed and rehydrated tissue sections were blocked with a Tris-carrageenan-Triton X-100 (TCT) solution containing 4% sheep serum (Sigma-Aldrich) and then incubated overnight at 4°C with a 1/100 dilution in TCT of the primary antibody 62-3G1 deposited in the Developmental Studies Hybridoma Bank (DSHB) by Angel L. De Blas (DSHB Hybridoma Product 62-3G1). This antibody recognizes both the β2 and β3 subunits of GABA_A receptors. Tissue sections were then incubated in a 1/200 dilution in phosphate-buffered saline (PBS) with 0.1% Triton X-100 (PBST) of the secondary antibody anti-mouse IgG (whole-molecule)-peroxidase antibody produced in rabbit (A9044, Sigma-Aldrich) for 1 h at room temperature. Colour was developed using 3,3′-diaminobenzidine (DAB; D12384, Sigma-Aldrich) as the chromogen in a solution containing 0.05% DAB, 0.015% H₂O₂ (H1009, Sigma-Aldrich) in 0.15 mol l⁻¹ PBS pH 7.2 for 10 min at room temperature. The reaction was stopped by washing sections for 5 min in the same buffer. Sections were then dehydrated, cleared in xylene and mounted in dibutylphthalate polystyrene xylene (DPX; Merck, Sigma-Aldrich). Control reactions in which the primary antisera were omitted from the staining procedure were negative. Stained sections were analysed using a microscope (Leica DM2000) coupled to a digital camera (Leica DFC480) and linked to a computer for digital image analysis.

To investigate the role of GABA_A receptors in the olfactory epithelium, olfactory sensitivity to amino acids was tested in the presence and absence of GABA, gabazine (allosteric inhibitor of the GABA_A receptor) or muscimol (GABA_A receptor agonist). Gabazine was from Merk Millipore; muscimol and GABA were from Sigma-Aldrich.

Firstly, the olfactory sensitivity of fish to each drug was evaluated at 10 µmol l⁻¹ (the concentration of gabazine used in many behavioural studies). Olfactory sensitivity to amino acids was then tested, in the absence and then the presence of GABA, gabazine or muscimol (only one drug tested on each fish). The olfactory epithelium was superfused for 10 min with seawater containing the drug prior to recording responses to odorants. All odorants tested during this stage were prepared in the presence of the drug at the same concentration as the water superfusing the olfactory epithelium. After testing, the olfactory epithelium was washed out for 15 min with seawater. In all cases, the amplitude of the response returned to control levels. The percentage response was calculated by dividing the amplitude of the olfactory response in the presence of the drug by that in its absence.

Seabream were anaesthetized in aerated natural seawater containing 300 mg l⁻¹ MS222 (ethyl-3-aminobenzoate methane sulphonate salt, Sigma-Aldrich) until responses to tail pinch had stopped; an intramuscular injection of the neuromuscular blocker gallamine triethiodide (Sigma-Aldrich; 10 mg kg⁻¹ in 0.9% NaCl) was then given. Fish were then placed in a padded V-support and the gills irrigated with aerated natural seawater containing 150 mg l⁻¹ MS222.

The olfactory rosette was exposed by cutting the skin and connective tissue overlying the nasal cavity. The nostril was constantly irrigated with charcoal-filtered sea water (without anaesthetic) under gravity (flow rate: 6 ml min⁻¹) via a glass tube. Test solutions were delivered to the tube irrigating the nasal cavity via a computer-operated three-way solenoid valve for 4 s. The olfactory nerve was exposed by removal of the skin, connective tissue and overlying bone. Olfactory nerve activity was recorded using tungsten microelectrodes (0.1 MΩ, World Precision Instruments) as previously described (Hubbard and Velez, 2020). The electrodes were placed in the olfactory nerve in a position that gave maximal response to 10⁻³ mol l⁻¹l-serine, usually lateral and close to the olfactory bulb. Fish were connected to earth via a copper wire inserted in the flank. The raw signal was amplified (20,000×; AC pre-amplifier, Neurolog NL104, Digitimer Ltd, Welwyn Garden City, UK), filtered (high pass: 200 Hz, low pass: 3000 Hz; Neurolog NL125, Digitimer Ltd) and integrated (time constant 1 s; Neurolog NL703, Digitimer Ltd). Raw and integrated signals were digitized (Digidata 1440A, Molecular Devices, San Jose, CA, USA) and recorded on a PC running AxoScope™ software (version 10.6, Molecular Devices).

All integrated response amplitudes were normalized to the amplitude of the integrated response to 10⁻³ mol l⁻¹l-serine (the ‘standard’). Responses to the standard were recorded regularly at the beginning and end of each group of samples (every 3–5 samples) throughout the recording session. Each stimulus was applied for 4 s, with at least 1 min between odorants to allow complete recovery of the receptors (Hubbard and Velez, 2020).

All statistical analyses of electrophysiological results were carried out on normalized data. Differences between olfactory responses in the presence and absence of each drug were analysed using Student's t-test for paired data (log-transformed). All the analyses were performed in GraphPad Prism 9.0.2 (134) for Mac OS X (GraphPad Software, La Jolla, CA, USA; www.graphpad.com). The significance cut-off was set at P<0.05 and data are presented as means±s.e.m., unless otherwise stated.

The mRNA expression of gabra1 and gabbr2 subunits of GABA receptors was quantified in the olfactory epithelium of gilthead seabream (Fig. 1A) suggesting the presence of both ionotropic and metabotropic GABA receptors. The presence of cells with GABA_A receptors in the olfactory epithelium was evaluated by immunohistochemistry using an antibody (62-3G1, DSHB) against type A receptors and revealed positive immunostaining in small rounded cell bodies (Fig. 1B) along the apical side of the olfactory lamella.

Seabream responded to all drugs (GABA, gabazine and muscimol) at 10 µmol l⁻¹ (Fig. 2A) although not as strongly as to other amino acid odorants, such as l-serine. However, exposure of the epithelium to 10 µmol l⁻¹ GABA (Fig. 2B) and 10⁻⁵ mol l⁻¹ gabazine (Fig. 2C) did not affect the olfactory response to any of the amino acid odorants. In the presence of 10⁻⁵ mol l⁻¹ muscimol, the olfactory response to l-glutamic acid was significantly higher (t=7.08; P=0.006), and that to l-serine (t=4.46; P=0.021) and l-cysteine (t=3.43; P=0.041) were lower (Fig. 2C,D).

The current study clearly shows the expression of both ionotropic and metabotropic GABA receptors in the olfactory epithelium of seabream. In addition, immunohistochemistry showed the presence of the β2 and/or β3 subunits of the GABA_A receptor in the olfactory epithelium. The near-apical position of the staining within the epithelium suggests that the GABA_A receptor is expressed in olfactory receptor neurones, possibly the microvillous cells (Hamdani and Døving, 2007; Hansen et al., 2004); however, the exact site of expression remains to be determined experimentally. In an attempt to evaluate the modulatory effect of GABA receptors, the response to a range of amino acids in the presence and absence of GABA, gabazine and muscimol was compared. GABA, the endogenous ligand of GABA receptors, binds to both metabotropic and ionotropic receptors. Conversely, gabazine is a specific and potent allosteric modulator of GABA_A receptors, where it acts as an allosteric inhibitor of channel opening (Ueno et al., 1997). Muscimol is a naturally occurring specific agonist of GABA_A receptors (Johnston, 2014). Therefore, the effect of gabazine was expected to be opposite to that of GABA and muscimol. However, neither GABA nor gabazine altered olfactory responses to the amino acid odorants, whereas muscimol increased olfactory nerve response to L-glutamic acid but decreased it to l-serine and l-cysteine. The difference between the effects of GABA and muscimol (agonists) may be because GABA activates both metabotropic and ionotropic receptors, while muscimol activates only GABA_A receptors. Alternatively, the penetration of the two compounds into the epithelium may be different. The lack of effect of gabazine could be because GABA is not released in the olfactory epithelium under experimental conditions (e.g. under anaesthesia); thus, GABA_A receptors are not activated and, therefore, exposure of the olfactory epithelium to a GABA_A receptor inhibitor has no effect.

Our study clearly shows the transcription and presence of GABA_A receptors in the olfactory epithelium of seabream. As far as we are aware, only one other study has identified these receptors in the olfactory epithelium of an aquatic vertebrate: Xenopus tadpoles (Kaeser et al., 2011). Furthermore, in the seabream, the activation of these receptors alters the olfactory response to some – but not all – odorants, in the current case increasing sensitivity to l-glutamate and decreasing it to l-serine and l-cysteine. We hypothesize that, similar to taste receptors (Huang et al., 2011), GABA receptors may modulate the olfactory response at a peripheral level. In taste buds, GABA acts as an inhibitory transmitter released during taste stimulation, acting on both GABA_A and GABA_B receptors (Dvoryanchikov et al., 2011). Furthermore, acid stimulation seems to elicit GABA release from mouse taste cells (Huang et al., 2011). Although the exact function of GABA_A receptors in the olfactory epithelium is not yet clear, it may complicate the interpretation of those studies wherein water-borne gabazine is used to reverse the effects of high CO₂ levels on olfactory-driven behaviour in fish as it could alter the perception of a given odour. Nevertheless, the effect of stimulating these receptors in the olfactory epithelium on fish behaviour awaits investigation.

The monoclonal antibody 62-3G1 developed by Angel L. De Blas was obtained from the Developmental Studies Hybridoma Bank, created by the NICHD of the NIH and maintained at The University of Iowa, Department of Biology (Iowa City, IA 52242, USA).