...Heike Wollmann; Erica Mica; Marco Todesco; Jeff A. Long; Detlef Weigel The ABC model of flower development explains how three classes of homeotic genes confer identity to the four types of floral organs. In Arabidopsis thaliana, APETALA2 ( AP2 ) and AGAMOUS ( AG ) represent A- and C-class genes...

... in trxG and PcG genes can antagonize each other's function, whereas mutations of genes within each group have synergistic effects. Here, we show in Drosophila that multiple trxG and PcG proteins act through the same or juxtaposed sequences in the maintenance element (ME) of the homeotic gene Ultrabithorax...

... of Kansas, Lawrence, KS 66045, USA 7 9 2007 © 2007. 2007 Petal identity Homeotic genes MADS-box genes Poppy Papaver somniferum Nearly all angiosperm flowers possess a perianth, a series of sterile organs that surround the reproductive organs - the stamens and carpels...

...). PcG genes are essential genes in higher eukaryotes responsible for the maintenance of the spatially distinct repression of developmentally important regulators such as the homeotic genes. Their absence, as well as overexpression, causes transformations in the axial organization of the body. Although...

...Concepción Gómez-Mena; Stefan de Folter; Maria Manuela R. Costa; Gerco C. Angenent; Robert Sablowski Floral organs, whose identity is determined by specific combinations of homeotic genes, originate from a group of undifferentiated cells called the floral meristem. In Arabidopsis , the homeotic...

.... * Author for correspondence (e-mail: calexan@nimr.mrc.ac.uk ) 11 11 2002 © 2003. 2003 Drosophila Transcriptional repression and activation Engrailed Hedgehog Wingless signaling Extradenticle Homeotic genes Engrailed (En) comprises a homeodomain that recognizes specific...

...Sylvain Poux; Béatrice Horard; Christian J. A. Sigrist; Vincenzo Pirrotta Polycomb group (PcG) and Trithorax (TRX) complexes assemble at Polycomb response elements (PREs) and maintain respectively the repressed and active state of homeotic genes. Although PcG and TRX complexes are distinct...

... and it was not possible to use confocal microscopy in stage 13 embryos. *Author for correspondence (e-mail: Markus.Affolter@unibas.ch ) 8 5 2001 © 2001. 2001 DPP Signaling Homeotic genes Endoderm Induction Transcription Gene regulation The progressive determination of cells...

... of a Drosophila homeotic gene . Development 126 , 3905 – 3913 . 10.1242/dev.126.17.3905 Garcia , E. , Marcos-Gutierrez , C. , del Mar Lorente , M. , Moreno , J. C. and Vidal , M. ( 1999 ). RYBP, a new repressor protein that interacts with components of the mammalian Polycomb...

... 09 08 2000 © 2000 by Company of Biologists 2000 Antirrhinum Flower development Repressors Homeotic genes Ectopic expression Floral organ identity Floral organ identity in Antirrhinum majus is regulated through the combinatorial action of two classes of organ identity...

... homeoprotein may directly regulate the expression of most genes. * Author for correspondence (e-mail: biggin@minerva.cis.yale.edu ) 08 09 1998 20 10 1998 © 1998 by Company of Biologists 1998 Drosophila melanogaster Homeoproteins Homeotic genes Pair-rule genes Positional...

..., the gene lin-39 plays a central role as it is used twice during vulval cell fate specification. Early in the first larval stage (L1), lin-39 functions as a homeotic gene that specifies the vulva equivalence group. lin-39 mutant animals are vulvaless and the vulval precursor cells (VPCs) express fates...

... of Biologists 1998 Hox homeotic genes abdominal-A pointed odd paired wingless decapentaplegic Ultrabithorax Visceral mesoderm Ets Drosophila P1 return: GTTGTAGCCTGAACTAAAGAA; P2: GAATTGGCGATTTGTAAAACA; P2 return: CATTGTGGGAGTGGGGCGTGG. Lethal excision lines were...

...Patrick Motte; Heinz Saedler; Zsuzsanna Schwarz-Sommer ABSTRACT The identity and developmental pattern of the four organ types constituting the flower is governed by three developmental functions, A, B and C, which are defined by homeotic genes and established in two adjacent whorls. In this report...

... the occurrence of adaxial carpel-like structures bearing external ovules, seem to indicate that pat is a mutation of a putative gene with homeotic functions. Homeotic genes belonging to the family of MADS-box transcriptional factors, have recently been cloned in tomato ( Pnueli et al., 1991 ). Antisense down...

...Ana Busturia; Christopher D. Wightman; Shigeru Sakonju ABSTRACT Transcriptional silencing by the Polycomb Group of genes maintains the position-specific repression of homeotic genes throughout Drosophila development. The Polycomb Group of genes characterized to date encode chromatinassociated...

... pathway genes, we screened for mutations on loci on the Drosophila second chromosome that interact with the homeotic gene Deformed ( Dfd ). Genetic and molecular tests on the eight genes isolated in the screen place them in three general categories. Two genes appear to encode trithorax group functions...

... Medical Institute, Department of Genetics and Development, Columbia University, 701 West 168th Street, New York, NY 10032, USA 17 03 1997 © 1997 by Company of Biologists 1997 homeotic genes cooperative binding extradenticle pbx mouse Drosophila In Drosophila...

...Bryan T. Rogers; Michael D. Peterson; Thomas C. Kaufman ABSTRACT The products of the HOM/Hox homeotic genes form a set of evolutionarily conserved transcription factors that control elaborate developmental processes and specify cell fates in many metazoans. We examined the expression...

...). K.L.C. was supported by a Martin Foundation Postdoctoral Fellowship. This work was supported by NIH grant R01 GM39353. REFERENCES Andrew , D. J. and Scott , M. P. ( 1992 ). Downstream of the homeotic genes . New Biol . 4 , 5 – 15 . Austin , J. and Kenyon , C...