1-20 of 35
Keywords: Ultrabithorax
Close
Follow your search
Access your saved searches in your account

Would you like to receive an alert when new items match your search?
Close Modal
Sort by
Journal Articles
Journal: Development
Development (2018) 145 (13): dev161844.
Published: 9 July 2018
... , the wings and halteres, homologous appendages of the second and third thoracic segments, respectively, bear different forms: wings are flat, whereas halteres are globular, and yet both characteristic shapes are essential for a normal flight. The Hox gene Ultrabithorax ( Ubx ) governs the difference between...
Includes: Supplementary data
Journal Articles
Journal Articles
Journal: Development
Development (2010) 137 (17): 2951–2960.
Published: 1 September 2010
...Stefan Thomsen; Ghows Azzam; Richard Kaschula; Lucy S. Williams; Claudio R. Alonso The Drosophila Hox gene Ultrabithorax ( Ubx ) controls the development of thoracic and abdominal segments, allocating segment-specific features to different cell lineages. Recent studies have shown that Ubx...
Includes: Supplementary data
Journal Articles
Journal Articles
Journal: Development
Development (2006) 133 (22): 4495–4506.
Published: 15 November 2006
...Luis F. de Navas; Daniel L. Garaulet; Ernesto Sánchez-Herrero The halteres and wings of Drosophila are homologous thoracic appendages, which share common positional information provided by signaling pathways. The activity in the haltere discs of the Ultrabithorax ( Ubx ) Hox gene establishes...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2005) 132 (23): 5271–5281.
Published: 1 December 2005
...Ella Tour; Chris Todd Hittinger; William McGinnis While testing the functions of deletion mutants in the Hox protein Ultrabithorax (Ubx), we found that the embryonic repression function of Ubx on Distal-less transcription in limb primordia is highly concentration dependent. The steep sigmoidal...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2005) 132 (23): 5261–5270.
Published: 1 December 2005
... conserved regulatory proteins with many roles evolve new functions while maintaining old functions. We have investigated this by analyzing the function of the `QA' peptide motif of the Hox protein Ultrabithorax (Ubx), a motif that has been conserved throughout insect evolution since its establishment early...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2005) 132 (7): 1567–1577.
Published: 1 April 2005
...), and a cluster of binding sites for repression by the Hox protein Ultrabithorax (UBX). The negative and positive control regions are physically separable, demonstrating that UBX does not repress by competing for occupancy of Ci-binding sites. Although knot expression is conserved among Drosophila species...
Journal Articles
Journal: Development
Development (2003) 130 (20): 4931–4941.
Published: 15 October 2003
... ), decapentaplegic ( dpp ), patched ( ptc ), combsgap , Capichua (Cic), teashirt ( tsh ), Broad complex genes, E74A, DHR3,hep and Ultrabithorax ( Ubx ) are expressed in the PM of wing imaginal discs ( White and Wilcox,1985 ; Brower, 1987 ; Boyd et al., 1991 ; Emery et al., 1994 ; Lam et al., 1997...
Journal Articles
Journal: Development
Development (2003) 130 (8): 1537–1547.
Published: 15 April 2003
...Mohit Prasad; Ruchi Bajpai; L. S. Shashidhara In the third thoracic segment of Drosophila , wing development is suppressed by the homeotic selector gene Ultrabithorax ( Ubx )in order to mediate haltere development. Previously, we have shown that Ubx represses dorsoventral (DV) signaling to specify...
Journal Articles
Journal Articles
Journal: Development
Development (2002) 129 (13): 3115–3126.
Published: 1 July 2002
... proteins also regulate target genes in the absence of cofactors. In Drosophila melanogaster , the Hox protein Ultrabithorax (Ubx) promotes haltere development and suppresses wing development by selectively repressing many genes of the wing-patterning hierarchy, and this activity requires neither Exd nor...
Journal Articles
Journal: Development
Development (2002) 129 (5): 1225–1238.
Published: 1 March 2002
... for correspondence (e-mail: kaufman@bio.indiana.edu ) 12 12 2001 © 2002. 2002 Body plan Centipede Chilopoda Lithobius Hox labial proboscipedia Hox3 Deformed Sex combs reduced fushi tarazu Antennapedia Ultrabithorax abdominal-A Abdominal-B Over 500...
Journal Articles
Journal: Development
Development (1999) 126 (4): 701–710.
Published: 15 February 1999
..., Oregon Health Sciences University, Portland, OR 97201, USA * Author for correspondence 04 12 1998 20 12 1999 © 1999 by Company of Biologists 1999 Nasonia caudal hunchback engrailed Ultrabithorax abdominal-A Drosophila Zygotic control...
Journal Articles
Journal: Development
Development (1998) 125 (22): 4541–4552.
Published: 15 November 1998
... of the Ultrabithorax gene, pairing of homologous alleles surprisingly was reduced only to 20-30%. A zeste protein null mutation neither delayed the onset of pairing nor led to unpairing of the homologous alleles. These data are discussed in the light of different models for trans -regulation. We examined the onset...
Journal Articles
Journal: Development
Development (1998) 125 (9): 1781–1790.
Published: 1 May 1998
... of Biologists 1998 Hox homeotic genes abdominal-A pointed odd paired wingless decapentaplegic Ultrabithorax Visceral mesoderm Ets Drosophila P1 return: GTTGTAGCCTGAACTAAAGAA; P2: GAATTGGCGATTTGTAAAACA; P2 return: CATTGTGGGAGTGGGGCGTGG. Lethal excision lines were...
Journal Articles
Journal: Development
Development (1997) 124 (17): 3333–3341.
Published: 1 September 1997
... they fuse and are unable to ‘switch on’ a thoracic muscle-specific reporter gene. This process is likely to be mediated by homeotic repression because mis-expression of an abdominal muscle-specific homeotic gene, Ultrabithorax , in the thoracic muscles results in the repression of the thoracic muscle...
Journal Articles
Journal: Development
Development (1996) 122 (11): 3419–3432.
Published: 1 November 1996
... in developing insect embryos provides a basis for discussion of the generality of the parasegment and the evolution of Engrailed patterns. 07 08 1996 © 1996 by Company of Biologists 1996 insect head evolution engrailed Ultrabithorax dorsal ridge Siphonaptera Orthoptera Diptera...
Journal Articles
Journal Articles
Journal: Development
Development (1996) 122 (3): 747–751.
Published: 1 March 1996
..., and marked the FRT-generated cell clone by co-expressing β-galactosidase. Co-expression is achieved by a stretch of 5′ untranslated mRNA from the homeotic gene Ultrabithorax ( Ubx ), which is inserted between the two coding sequences. We show that this Ubx sequence mediates efficient and reliable di...