1-20 of 60
Keywords: Myogenesis
Close
Follow your search
Access your saved searches in your account

Would you like to receive an alert when new items match your search?
Close Modal
Sort by
Journal Articles
Journal: Development
Development (2021) 148 (1): dev193813.
Published: 4 January 2021
... (forward), AGAGTGCGAACCAGTTATGGC; Raldh3 (reverse), ATCTCCTTCTTCCACCTCACATA. Summary: Positive feedback between Meis and retinoic acid regulates axial skeleton patterning in the mouse embryo. Embryo patterning Homeodomain Homeotic transformation Myogenesis Skeletal patterning...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2020) 147 (19): dev185975.
Published: 9 October 2020
... Myogenesis Muscle development in mouse takes place from embryonic day (E) 8 when the first Myf5 expressing cells are detected in somites, and ends at the adult stage when muscle masses stop growing during homeostasis. Sequential waves of myogenesis build the hundreds of individual muscles...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2020) 147 (7): dev184507.
Published: 6 April 2020
... and misregulation of genes involved in muscle differentiation. Deletion of Myh3 during embryonic myogenesis leads to the depletion of the myogenic progenitor cell pool and an increase in the myoblast pool, whereas fetal myogenesis-specific deletion of Myh3 causes the depletion of both myogenic progenitor...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2020) 147 (3): dev183624.
Published: 7 February 2020
...Shuo Yang; Allison Weske; Yingqiu Du; Juliana M. Valera; Kenneth L. Jones; Aaron N. Johnson ABSTRACT Nascent myotubes undergo a dramatic morphological transformation during myogenesis, in which the myotubes elongate over several cell diameters and are directed to the correct muscle attachment sites...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2019) 146 (6): dev167080.
Published: 19 March 2019
...Shuang Cui; Liang Li; Ruth T. Yu; Michael Downes; Ronald M. Evans; Julie-Ann Hulin; Helen P. Makarenkova; Robyn Meech ABSTRACT Canonical Wnts promote myoblast differentiation; however, the role of β-catenin in adult myogenesis has been contentious, and its mechanism(s) unclear. Using CRISPR...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2019) 146 (2): dev169003.
Published: 18 January 2019
...://www.biologists.com/user-licence-1-1/ Summary: A fundamentally different mechanism is demonstrated for how Ras signaling governs cell fate specification in the Drosophila somatic versus visceral mesoderms, providing insight into how signaling specificity is achieved. Myogenesis Signal integration...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2016) 143 (15): 2853–2861.
Published: 1 August 2016
... are regulators of actin cycling and cytoskeletal gene expression. Loss of MRTFs in the mouse skeletal muscle causes muscle hypoplasia due to defects in sarcomere formation. Myogenesis MRTF SRF Actin cycling Myopathy Myocardin-related transcription factors A and B (MRTF-A and MRTF-B; also known...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2015) 142 (19): 3440–3452.
Published: 1 October 2015
...Jessica Williams; Nathan G. Boin; Juliana M. Valera; Aaron N. Johnson For skeletal muscle to produce movement, individual myofibers must form stable contacts with tendon cells and then assemble sarcomeres. The myofiber precursor is the nascent myotube, and during myogenesis the myotube completes...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2015) 142 (14): 2405–2412.
Published: 15 July 2015
...Amar J. Majmundar; David S. M. Lee; Nicolas Skuli; Rickson C. Mesquita; Meeri N. Kim; Arjun G. Yodh; Michelle Nguyen-McCarty; Bo Li; M. Celeste Simon Deeper insight into the molecular pathways that orchestrate skeletal myogenesis should enhance our understanding of, and ability to treat, human...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2015) 142 (9): 1572–1581.
Published: 1 May 2015
... and intrinsic regulatory mechanisms. Satellite cell Muscle stem cell Myogenesis Quiescence Cell cycle regulation Asymmetric division Self-renewal Skeletal muscle Regeneration Aging Other types of asymmetric divisions and asymmetric segregations of factors have also been described...
Journal Articles
Journal: Development
Development (2014) 141 (14): 2780–2790.
Published: 15 July 2014
... of Biologists Ltd 2014 Myogenesis Cell cycle regulation p57 kip2 Cdkn1 Notch signaling MRF The formation of functional organs of an appropriate size is highly controlled during development. Organ transplantation and regeneration studies have revealed that organ size relies on both intrinsic...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2014) 141 (13): 2611–2620.
Published: 1 July 2014
... signaling suppressed both head and trunk myogenesis. Our findings, corroborated by mathematical modeling, suggest that ERK shuttling between the nucleus and the cytoplasm provides a switch-like transition between proliferation and differentiation of muscle progenitors. Competing interests The authors...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2013) 140 (24): 4914–4925.
Published: 15 December 2013
... ). Cooperative synergy between NFAT and MyoD regulates myogenin expression and myogenesis . J. Biol. Chem. 283 , 29004 – 29010 . Armand A.-S. , Laziz I. , Djeghloul D. , Lécolle S. , Bertrand A. T. , Biondi O. , De Windt L. J. , Chanoine C. ( 2011 ). Apoptosis...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2013) 140 (17): 3645–3656.
Published: 1 September 2013
... about the molecular mechanisms that control the early stages of muscle morphogenesis. To explore this facet of myogenesis, we performed a genetic screen for regulators of somatic muscle morphology in Drosophila , and identified the putative RNA-binding protein (RBP) Hoi Polloi (Hoip). Hoip is expressed...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2013) 140 (6): 1231–1239.
Published: 15 March 2013
... between E12 and E14.5. The secondary wave of myogenesis (fetal wave), resulting in terminal differentiation of the myotubes, begins at E14.5 ( Buckingham, 2007 ; Sambasivan and Tajbakhsh, 2007 ). We first determined the size of the diaphragm at E13.5, E15.5 and E18.5 in the various mutant embryos ( n =3...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2012) 139 (21): 4040–4050.
Published: 1 November 2012
...Boaz Gildor; Eyal D. Schejter; Ben-Zion Shilo A major aspect of indirect flight muscle formation during adult Drosophila myogenesis involves transition of a semi-differentiated and proliferating pool of myoblasts to a mature myoblast population, capable of fusing with nascent myotubes...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2012) 139 (19): 3572–3582.
Published: 1 October 2012
... and Molecular Biophysics, Columbia University, 701 West 168th Street, HHSC 1104 New York, NY 10032, USA Competing interests statement The authors declare no competing financial interests 9 7 2012 © 2012. Tailup/Islet1 Collier/EBF Tinman/Nkx2.5 Myogenesis Temporal...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2012) 139 (9): 1640–1650.
Published: 1 May 2012
... development. TGFβ family members play important roles in regulating myogenesis, but the functional significance of Smad-dependent TGFβ signaling in regulating tongue skeletal muscle development remains unclear. In this study, we have investigated Smad4-mediated TGFβ signaling in the development of occipital...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2012) 139 (7): 1270–1275.
Published: 1 April 2012
... of myogenesis. These include using conditional mutant mice, using morpholinos in zebrafish and using hypomorphic mutants in Drosophila adult development. However, we show here that Mef2 is absolutely required for a diverse range of Drosophila adult muscle types. These include the dorso-longitudinal muscles...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2012) 139 (5): 958–967.
Published: 1 March 2012
... MyoD Myogenesis Tcf21 During embryonic development, precursor cells of four different mesodermal origins follow distinct routes to form skeletal muscles (reviewed by Carvajal and Rigby, 2010 ). These progenitors can activate the myogenic program in situ, before or after initiating...
Includes: Supplementary data