1-20 of 30
Keywords: Homeodomain
Follow your search
Access your saved searches in your account

Would you like to receive an alert when new items match your search?
Close Modal
Sort by
Journal Articles
Journal: Development
Development (2021) 148 (1): dev193813.
Published: 4 January 2021
... (forward), AGAGTGCGAACCAGTTATGGC; Raldh3 (reverse), ATCTCCTTCTTCCACCTCACATA. Summary: Positive feedback between Meis and retinoic acid regulates axial skeleton patterning in the mouse embryo. Embryo patterning Homeodomain Homeotic transformation Myogenesis Skeletal patterning...
Includes: Supplementary data
Journal Articles
In collection:
Plant development
Journal: Development
Development (2018) 145 (9): dev157081.
Published: 30 April 2018
...Simon Scofield; Alexander Murison; Angharad Jones; John Fozard; Mitsuhiro Aida; Leah R. Band; Malcolm Bennett; James A. H. Murray ABSTRACT The Arabidopsis homeodomain transcription factor SHOOT MERISTEMLESS (STM) is crucial for shoot apical meristem (SAM) function, yet the components and structure...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2016) 143 (8): 1351–1362.
Published: 15 April 2016
... of Drosophila sensory neurons is diversified through a series of suppressive transcriptional interactions involving the POU domain transcription factors Pdm1 (Nubbin) and Pdm2, the homeodomain transcription factor Cut, and the transcriptional regulators Scalloped and Vestigial. Pdm1 and Pdm2 are expressed...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2015) 142 (7): 1212–1227.
Published: 1 April 2015
...René Rezsohazy; Andrew J. Saurin; Corinne Maurel-Zaffran; Yacine Graba Hox genes encode homeodomain transcription factors that control morphogenesis and have established functions in development and evolution. Hox proteins have remained enigmatic with regard to the molecular mechanisms that endow...
Journal Articles
Journal: Development
Development (2013) 140 (4): 719–729.
Published: 15 February 2013
..., dorsal-ventral and medial-lateral axes. Wnt and several Hox genes are expressed at the posterior pole, whereas Wnt inhibitory genes, Fgf inhibitory genes, and prep , which encodes a TALE-family homeodomain protein, are expressed at the anterior pole. We found that Smed-pbx ( pbx for short), which encodes...
Includes: Multimedia, Supplementary data
Journal Articles
Journal: Development
Development (2012) 139 (6): 1164–1174.
Published: 15 March 2012
...Brian W. Busser; Leila Shokri; Savina A. Jaeger; Stephen S. Gisselbrecht; Aditi Singhania; Michael F. Berger; Bo Zhou; Martha L. Bulyk; Alan M. Michelson A subfamily of Drosophila homeodomain (HD) transcription factors (TFs) controls the identities of individual muscle founder cells (FCs). However...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2011) 138 (22): 4853–4865.
Published: 15 November 2011
... on the homeodomain-containing transcription factor Nanog. Compared with other pluripotency-associated genes, however, Nanog shows relatively low sequence conservation. Here, we investigated whether Nanog orthologs have the capacity to orchestrate establishment of pluripotency in Nanog –/– somatic cells. Mammalian...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2010) 137 (23): 4051–4060.
Published: 1 December 2010
... tissues, but little is known about how small differences in the concentration of extracellular signals are translated into robust patterning output in responding cells. We have examined the activity of homeodomain proteins, which are presumed to operate downstream of graded Shh signaling in neural...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2010) 137 (12): 2065–2074.
Published: 15 June 2010
... mutants. One of these corresponds to the LIM class homeodomain (HD) protein CEH-14/Lhx3, and the other two correspond to Paired-like HD proteins CEH-10/Chx10 and CEH-17/Phox2. Whereas CEH-14 is required for ALA-specific gene expression throughout development, the Prd-like proteins display complementary...
Journal Articles
Journal: Development
Development (2010) 137 (3): 437–445.
Published: 1 February 2010
...Ulrika Marklund; Emil M. Hansson; Erik Sundström; Martin Hrabé de Angelis; Gerhard K. H. Przemeck; Urban Lendahl; Jonas Muhr; Johan Ericson Homeodomain (HD) transcription factors and components of the Notch pathway [Delta1 (Dll1), Jagged1 (Jag1) and the Fringe (Fng) proteins] are expressed...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2006) 133 (7): 1311–1322.
Published: 1 April 2006
...David A. Elliott; Mark J. Solloway; Natalie Wise; Christine Biben; Mauro W. Costa; Milena B. Furtado; Martin Lange; Sally Dunwoodie; Richard P. Harvey Homeodomain factor Nkx2-5 is a central component of the transcription factor network that guides cardiac development; in humans, mutations in NKX2.5...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2005) 132 (18): 4119–4130.
Published: 15 September 2005
... to study mechanisms coordinating these events at single cell resolution. We have identified an HMX homeodomain protein MLS-2 in a screen for factors required for M lineage patterning. The MLS-2 protein is present in nuclei of undifferentiated cells in the early M lineage and in a subset of head neurons...
Journal Articles
Journal: Development
Development (2004) 131 (24): 6131–6140.
Published: 15 December 2004
... and patterning. To understand how Pax6 coordinates these diverse effects at the molecular level, we examined the role of distinct DNA-binding domains of Pax6, the homeodomain (HD), the paired domain (PD) and its splice variant (5a), using loss- and gain-of-function approaches. Here we show that the PD...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2004) 131 (20): 5153–5165.
Published: 15 October 2004
... for Antennapedia superclass homeodomain proteins. Chromatin immunoprecipitation and mutagenesis experiments indicate that the GCCG sites are direct targets of BMP restricted Smads. Intriguingly, however, these sites are not sufficient for BMP responsiveness in mouse embryos; the TTAATT sequence is also required...
Journal Articles
Journal: Development
Development (2003) 130 (22): 5385–5400.
Published: 15 November 2003
... of hypomorphic mutants ( Nüsslein-Volhard and Wieschaus, 1980 ). In order to function as a segmentation gene,the transcriptional repressor function of the gene product Eve is required,and also appears to be sufficient, in the context of the Eve homeodomain (HD)( Fujioka et al., 1995 ; Fujioka et al., 2002...
Journal Articles
Journal: Development
Development (2003) 130 (18): 4351–4362.
Published: 15 September 2003
... MP moved freely from epidermis to mesophyll, demonstrating that the PDs between epidermal and mesophyll cells are open to both diffusion-mediated and selective protein movement. Homeodomain KNOX Shoot meristem knotted1 GFP Plasmodesmata Protein trafficking Arabidopsis thaliana...
Journal Articles
Journal: Development
Development (2003) 130 (18): 4383–4392.
Published: 15 September 2003
... the characterization of the mutant Pph13 hazy . Pph13 is a homeodomain transcription factor expressed only in photoreceptor cells. Pph13 expression correlates with the differentiation and not specification of photoreceptor cells. In agreement with its expression profile, we find Pph13 is required for both rhabdomere...
Journal Articles
Journal: Development
Development (2003) 130 (13): 2841–2852.
Published: 1 July 2003
...Savita Ayyar; Jianqiao Jiang; Anna Collu; Helen White-Cooper; Robert A. H. White We have investigated the role of TGIF, a TALE-class homeodomain transcription factor, in Drosophila development. In vertebrates, TGIF has been implicated, by in vitro analysis, in several pathways, most notably...
Journal Articles
Journal: Development
Development (2003) 130 (9): 1867–1876.
Published: 1 May 2003
... in this interaction were identified. In Foxa2 the interacting domain is the Forkhead box DNA-binding domain. In Engrailed, two independent interacting domains exist: the homeodomain and a region that includes the Pbx-binding domain. Finally, Foxa2 not only binds Engrailed but also Lim1, Gsc and Hoxa5 homeoproteins...
Journal Articles
Journal: Development
Development (2003) 130 (9): 1915–1925.
Published: 1 May 2003
...Donald J. van Meyel; John B. Thomas; Alan D. Agulnick LIM-homeodomain transcription factors control a variety of developmental processes, and are assembled into functional complexes with the LIM-binding co-factor Ldb1 (in mouse) or Chip (in Drosophila ). We describe the identification...