1-19 of 19
Keywords: Actin cytoskeleton
Close
Follow your search
Access your saved searches in your account

Would you like to receive an alert when new items match your search?
Close Modal
Sort by
Journal Articles
Journal: Development
Development (2020) 147 (23): dev193425.
Published: 11 December 2020
... polarity and epidermal morphogenesis. Actin cytoskeleton Adherens junctions Epidermis Morphogenesis Planar cell polarity Proper polarization of cells and cellular structures along the plane of a tissue, or planar cell polarity (PCP), is essential for embryonic development and tissue...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2020) 147 (22): dev194555.
Published: 15 November 2020
..., ventral abdomen and the developing limbs. Around E13.5 they also migrate upward through the dermis and into the epidermis, crossing the basement membrane where they reside in hair follicles ( Mayer, 1973 ; Thomas and Erickson, 2008 ). Arp2/3 Melanoblasts Migration Actin cytoskeleton Skin...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2020) 147 (3): dev183624.
Published: 7 February 2020
.../Rac GTPases in nascent myotubes and effects changes in the actin cytoskeleton. FGF signals are thus essential regulators of myotube guidance that act through cytoskeletal regulatory proteins to pattern the musculoskeletal system. We next checked for genetic interactions between htl and the Rho/Rac...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2019) 146 (14): dev176644.
Published: 18 July 2019
...) have a dynamic actin cytoskeleton that drives their expansion to a diameter of 10 μm. Although multiple proteins have been identified as components of RCs, we lack a basic understanding of how RC proteins interact together to form and regulate the RC cytoskeleton. Thus, here, we optimized a procedure...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2019) 146 (1): dev169219.
Published: 2 January 2019
... mutagenesis of HtsRC revealed its requirement in the recruitment of the ring canal F-actin cytoskeleton. We present genetic evidence consistent with HtsRC being the CRL3 Kelch substrate, as well as biochemical evidence indicating that HtsRC is ubiquitylated and degraded by the proteasome. Finally, we identify...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2016) 143 (6): 1029–1040.
Published: 15 March 2016
... 12 2015 29 1 2016 © 2016. Published by The Company of Biologists Ltd 2016 Summary:   In utero electroporation coupled with real-time imaging reveals that actin cytoskeleton dynamics during neuronal migration are controlled by the cooperation of reelin and cofilin. Neuronal...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2014) 141 (18): 3505–3516.
Published: 15 September 2014
... ). Collectively, these findings suggest that MCC activity is intimately linked to the actin cytoskeleton and the regulation of cell shape and morphogenesis. In an attempt to shed additional light on the disparate functions ascribed to MCC to date, we chose to isolate the zebrafish homolog of MCC...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2014) 141 (4): 929–939.
Published: 15 February 2014
..., and on the other hand identify singed as a new target of Breathless signal, establishing a link between guidance cues, the actin cytoskeleton and tracheal morphogenesis. Total number of embryos, DBs or terminal cells (n) are provided in text and figures. Error bars indicate standard error (s.e.). P -values were...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2013) 140 (15): 3230–3243.
Published: 1 August 2013
... and remains on the surfaces of nascent phagosomes for 4-6 minutes before disappearing ( Fig. 4Cb ; supplementary material Fig. S5 a-b). PtdIns(4,5) P 2 , which binds to many clathrin adaptors [including epsin ( Itoh et al., 2001 )], is a plasma membrane-enriched lipid essential for actin cytoskeleton...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2011) 138 (11): 2337–2346.
Published: 1 June 2011
... interests. 9 3 2011 © 2011. 2011 Capping Protein Hippo signaling pathway Actin cytoskeleton Drosophila discs epithelia The conserved Hippo (Hpo) signal transduction pathway has emerged as a crucial regulator of tissue size in both Drosophila and mammals ( Edgar, 2006...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2009) 136 (1): 95–105.
Published: 1 January 2009
... Chemistry, Centre for Biomedical Genetics, UMC Utrecht, Universiteitsweg 100, 3584 CG Utrecht,Netherlands 22 10 2008 © 2009. 2009 Lasp Oskar Actin cytoskeleton Drosophila In Drosophila melanogaster , maternally provided mRNAs and proteins are transported from the nurse...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2006) 133 (21): 4257–4267.
Published: 1 November 2006
... but failed to form a lumen, showing a disrupted apical Actin cytoskeleton ( Fig. 2B ,part ii, arrow; compare with wild type in Fig. 2B ). These observations demonstrate that apical Myosin II, together with Actin, is essential to correctly drive epithelial cell invagination and lumen formation. Fig. 2...
Includes: Multimedia, Supplementary data
Journal Articles
Journal: Development
Development (2006) 133 (18): 3629–3639.
Published: 15 September 2006
.... * Author for correspondence (e-mail: loc@nhlbi.nih.gov ) 20 7 2006 © 2006. 2006 Connexin 43 Neural crest cell Focal contact Actin cytoskeleton Cell motility Neural crest cells are ectomesenchymal cells derived by epithelialmesenchyme cell transformation from the dorsal...
Includes: Multimedia, Supplementary data
Journal Articles
Journal: Development
Development (2006) 133 (5): 957–966.
Published: 1 March 2006
...Tamás Matusek; Alexandre Djiane; Ferenc Jankovics; Damian Brunner; Marek Mlodzik; József Mihály Formins are involved in a wide range of cellular processes that require the remodeling of the actin cytoskeleton. Here, we have analyzed a novel Drosophila formin, belonging to the recently described...
Journal Articles
Journal: Development
Development (2005) 132 (10): 2389–2400.
Published: 15 May 2005
... tubules demonstrates that its activity is required to regulate the reorganisation of the actin cytoskeleton during the process of convergent extension. In addition, overexpression of cv-c in the developing tubules gives rise to actin-associated membrane extensions. Thus, Cv-c function is required...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2005) 132 (8): 1983–1994.
Published: 15 April 2005
... encodes a Drosophila member of the DCC immunoglobulin subfamily and is required for CNS and motor axon guidance. Cell 87 , 197 -204. Krause, M., Dent, E. W., Bear, J. E., Loureiro, J. J. and Gertler, F. B. ( 2003 ). Ena/VASP proteins: regulators of the actin cytoskeleton and cell migration. Annu...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2005) 132 (7): 1675–1686.
Published: 1 April 2005
... and embryos lacking maternal and zygotic Pten function display phenotypes consistent with a function for PTEN in the organization of the actin cytoskeleton. In freshly laid eggs, the germ plasm determinants oskar mRNA and Vasa are not localized properly to the posterior cytocortex and pole cells do not form...
Includes: Multimedia, Supplementary data
Journal Articles
Journal: Development
Development (2005) 132 (4): 805–816.
Published: 15 February 2005
... MO, 5′TTCACTTCAGATGTCAGTCATGCTG 3′; XLPA 2 MO, 5′ACCTCCAATGTTACAGCGCAGCCTC 3′. * Author for correspondence (e-mail: christopher.wylie@cchmc.org ) 1 12 2004 ©2005. 2005 Lysophosphatidic acid Actin cytoskeleton G-protein-coupled receptor Xenopus The actin...
Journal Articles
Journal: Development
Development (2001) 128 (14): 2793–2802.
Published: 15 July 2001
... and found it to be a large and complicated gene that encodes a pair of large conserved proteins of unknown biochemical function. 5 5 2001 © 2001. 2001 ‡Author for correspondence (e-mail: pna@virginia.edu ) furry Morphogenesis Actin cytoskeleton Drosophila The adult...