ABSTRACT
As the microtubule-organizing centers of most cells, centrosomes engineer the bipolar mitotic spindle required for error-free mitosis. Drosophila Pericentrin-like protein (PLP) directs formation of a pericentriolar material (PCM) scaffold required for PCM organization and microtubule-organizing center function. Here, we investigate the post-transcriptional regulation of Plp mRNA. We identify conserved binding sites for cytoplasmic polyadenylation element binding (CPEB) proteins within the Plp 3′-untranslated region and examine the role of the CPEB ortholog Oo18 RNA-binding protein (Orb) in Plp mRNA regulation. Our data show that Orb interacts biochemically with Plp mRNA to promote polyadenylation and PLP protein expression. Loss of orb, but not orb2, diminishes PLP levels in embryonic extracts. Consequently, PLP localization to centrosomes and its function in PCM scaffolding are compromised in orb mutant embryos, resulting in genomic instability and embryonic lethality. Moreover, we find that PLP overexpression restores centrosome scaffolding and rescues the cell division defects caused by orb depletion. Our data suggest that Orb modulates PLP expression at the level of Plp mRNA polyadenylation and demonstrates that the post-transcriptional regulation of core, conserved centrosomal mRNAs is crucial for centrosome function.
INTRODUCTION
Centrosomes are microtubule-organizing centers that function in spindle assembly during cell division, cilia and flagella formation, and intracellular trafficking (Vertii et al., 2016). The centrosome comprises a pair of centrioles embedded in pericentriolar material (PCM), a matrix of proteins that directs microtubule nucleation and organization (Palazzo et al., 1999). Centrosome function relies on cell cycle-dependent oscillations in PCM recruitment before mitotic onset, followed by PCM shedding at mitotic exit (Gould and Borisy, 1977; Khodjakov and Rieder, 1999). The mechanisms that regulate oscillations in centrosome activity remain incompletely understood.
In humans, PCM recruitment and microtubule organization is supported by pericentrin (PCNT) (Dictenberg et al., 1998; Zimmerman et al., 2004; Haren et al., 2009; Lee and Rhee, 2011; Chen et al., 2014; Kim et al., 2015). Consequently, deregulation of PCNT is associated with severe human genetic disorders, such as Down syndrome (also known as trisomy 21) and microcephalic osteodysplastic primordial dwarfism type II (MOPD II) (Jurczyk et al., 2004; Rauch et al., 2008; Delaval and Doxsey, 2010; Galati et al., 2018). Specifically, elevated levels of PCNT underlie the ciliary defects in trisomy 21-derived fibroblasts (Galati et al., 2018). Understanding how PCNT expression is regulated in healthy tissues and deregulated in developmental disorders remains a critical challenge.
In Drosophila, Pericentrin-like protein (PLP) is the ortholog of PCNT (Martinez-Campos et al., 2004) with conserved roles in PCM recruitment and scaffolding and microtubule organization (Dobbelaere et al., 2008; Lerit and Rusan, 2013; Galletta et al., 2014; Lerit et al., 2015; Richens et al., 2015; Roque et al., 2018; Galletta et al., 2020). Additionally, the spatial configuration of PCNT and PLP at centrosomes is identical, with their C termini proximal to centrioles and N termini extended into the PCM (Fu and Glover, 2012; Lawo et al., 2012; Mennella et al., 2012; Sonnen et al., 2012). Intriguingly, aspects of PCNT and Plp mRNA post-transcriptional regulation are also conserved, as both PCNT and Plp mRNAs localize to centrosomes (Lécuyer et al., 2007; Sepulveda et al., 2018; Chouaib et al., 2020; Ryder et al., 2020; Safieddine et al., 2021). Therefore, the study of Drosophila PLP will be valuable for improving our understanding of centrosome regulation as well as providing potential insights into the mechanisms of human disease linked to PCNT dysfunction.
How and why PCNT or Plp mRNAs localize to the centrosome is largely unknown, although recent work implicates a co-translational transport mechanism (Sepulveda et al., 2018; Chouaib et al., 2020; Safieddine et al., 2021). RNA localization coupled with translational control is a conserved regulatory paradigm used to generate spatial enrichments in gene activity and is essential for diverse cellular processes (reviewed by Cody et al., 2013; Buxbaum et al., 2015; Ryder and Lerit, 2018). RNA localization and translational control are often regulated by RNA-binding proteins (RBPs), which recognize cis-elements within the 3′-untranslated regions (UTRs) of target RNAs (Kislauskis et al., 1994).
One conserved family of RBPs implicated in RNA localization and translational control is the cytoplasmic polyadenylation element binding (CPEB) protein family (Mendez and Richter, 2001). CPEB proteins bind to target mRNAs through recognition of cytoplasmic polyadenylation element (CPE) motifs and promote mRNA polyadenylation following phosphorylation by Aurora A kinase (Mendez et al., 2000a; Mendez et al., 2000b; Hodgman et al., 2001). CPEB proteins promote the translation of some mRNA targets, such as c-mos (mos), p53, cyclin B1 and β-casein (Csn2) mRNAs (Stebbins-Boaz et al., 1996; Groisman et al., 2000; Mendez et al., 2000b; Cao and Richter, 2002; Choi et al., 2004; Burns and Richter, 2008; Burns et al., 2011), but represses the translation of others, including myc mRNA (Groisman et al., 2006). Furthermore, CPEB can mediate localization of its target mRNAs independently of its polyadenylation or translation activities, as shown with zonal occludens-1 (Tjp1) mRNA (Nagaoka et al., 2012).
Drosophila encodes two CPEB proteins, Oo18 RNA-binding protein (Orb) and Orb2 (Lantz et al., 1992; Hafer et al., 2011). Whereas Orb2 functions are best defined in the testis and central nervous system (Keleman et al., 2007; Mastushita-Sakai et al., 2010; Hafer et al., 2011; Xu et al., 2012), Orb regulates RNA localization and translation during oogenesis and early embryogenesis (Lantz et al., 1992; Christerson and McKearin, 1994; Chang et al., 2001; Castagnetti and Ephrussi, 2003; Rojas-Ríos et al., 2015). Orb is orthologous to mammalian CPEB1 and similarly promotes polyadenylation to regulate the stability and translation of its target mRNAs, including oskar (osk), gurken (grk), and Autophagy-related 12 (Atg12) mRNAs (Christerson and McKearin, 1994; Chang et al., 1999, 2001; Castagnetti and Ephrussi, 2003; Norvell et al., 2015; Rojas-Ríos et al., 2015; Davidson et al., 2016).
Recent transcriptomics identified numerous mRNA targets of Orb from Drosophila S2 cells and of CPEB1 from cultured mammalian cells (Stepien et al., 2016; Pascual et al., 2021). Among the Orb/CPEB1 mRNA targets are several mRNAs encoding centrosome proteins. In Xenopus and cultured mammalian cells, CPEB proteins also localize to centrosomes, and mRNAs localizing to spindle poles show enrichment of CPE motifs in their 3′-UTRs (Groisman et al., 2000; Blower et al., 2007; Eliscovich et al., 2008; Sharp et al., 2011; Pascual et al., 2021). These data are consistent with a model whereby CPEB proteins regulate components of the mitotic machinery. However, whether Orb contributes to the post-transcriptional regulation of centrosomal mRNAs remains to be investigated.
In this study, we analyzed the common mRNA targets of human CPEB1 and Drosophila Orb and identified PCNT/Plp mRNA. To test a role for Orb in regulating Plp mRNA, we identified a specific biochemical association between Orb and Plp mRNA and examined the role of Orb in Plp mRNA localization to centrosomes and translational control. Although dispensable for Plp mRNA localization, Orb specifically regulates PLP protein expression by promoting polyadenylation of the short Plp 3′-UTR. We demonstrate that Orb contributes to PLP protein localization and PCM organization at centrosomes, which is required for genome stability. Our data suggest that Plp mRNA is a crucial target of Orb that is required for embryonic viability and highlight the translational regulation of centrosomal mRNAs as important for centrosome activity and function.
RESULTS
Plp mRNA localizes at centrosomes during early embryogenesis
During the first 2 h of development, the Drosophila embryo develops as a syncytium wherein the somatic nuclei rapidly divide through abridged (S-M) mitotic cycles and migrate to the embryonic cortex prior to cellularization during nuclear cycle (NC) 14 (Rothwell and Sullivan, 1999). We recently reported that multiple mRNAs encoding proteins required for centrosome function, including Plp mRNA, localize to embryonic centrosomes in a cell cycle-dependent manner (Ryder et al., 2020). To analyze further how Plp mRNA localization to the centrosome is regulated by cell cycle progression, we performed single-molecule fluorescence in situ hybridization (smFISH) for Plp mRNA and a control transcript, Gapdh1 mRNA, throughout syncytial development and quantified mRNA distributions relative to centrosomes labeled with GFP-γ-Tubulin (GFP-γTub). Despite relatively fewer smFISH signals, consistent with lower levels of Plp mRNA expression relative to Gapdh1 (Graveley et al., 2011), some molecules of Plp mRNA overlapped with centrosomes (Fig. 1A,B, arrowheads). In contrast, Gapdh1 mRNA was dispersed throughout the cytoplasm and fewer molecules overlapped with centrosomes (Fig. 1C,D).
To compare the distributions of Plp versus Gapdh1 mRNAs quantitatively, we measured the percentage of mRNA overlapping centrosomes (0 µm away) using a custom Python package (Ryder et al., 2020; Ryder and Lerit, 2020). From this analysis, we observed significantly more Plp mRNA localized to centrosomes relative to Gapdh1 mRNA (3∼8-fold more Plp mRNA than Gapdh1 mRNA at interphase versus 2∼6-fold more at metaphase; Fig. 1E, Table S1). As the syncytial embryo undergoes successive nuclear divisions, the size of each pseudo-cell becomes progressively smaller (Foe and Alberts, 1983). Consequently, the percentage of mRNA residing near centrosomes increases with each NC. Nonetheless, Plp mRNA remained significantly enriched at centrosomes relative to Gapdh1 throughout syncytial development, particularly during interphase. Although the higher-expressing Gapdh1 mRNA showed less enrichment at centrosomes than Plp mRNA, it remains a formal possibility the overlap of Plp mRNA signals with centrosomes arises through spurious coincidence of red and green pixels. To test for spurious overlap, we compared Plp and Gapdh1 mRNA localization to the centrosome from NC 13 interphase images before and after rotating the RNA channel by 90°. Significantly less Plp mRNA overlapped with centrosomes after rotation, to a similar level as Gapdh1 mRNA. In contrast, Gapdh1 mRNA distributions remained unchanged following rotation (Fig. 1F). These data verify the specific and significant enrichment of Plp mRNA at centrosomes. Furthermore, imaging of Plp mRNA together with a GFP-PLP transgene revealed that Plp mRNA and protein partially overlap at centrosomes (Fig. 1G), as recently detected in cultured mammalian cells (Sepulveda et al., 2018; Safieddine et al., 2021). Taken together, we conclude that Plp mRNA localizes to centrosomes, likely via a dynamic process that may involve translational control.
Plp mRNA associates with Orb protein
RNA localization coupled with translational control is a conserved mechanism that functions in various cellular contexts and is commonly regulated by RBPs (reviewed by Buxbaum et al., 2015; Das et al., 2021). Transcriptomics has uncovered thousands of predicted direct mRNA targets of Orb and Orb2 in Drosophila S2 cells (Stepien et al., 2016). Analysis in HeLa cells also uncovered thousands of putative mRNA targets of orthologous CPEB1 and CPEB4 (Pascual et al., 2021). We compared the RNA substrates of homologous Orb and CPEB1 proteins (Hake and Richter, 1994) identified in the Stepien and Pascual datasets and found 195 common genes (Fig. 2A; Table S2). Analysis of the gene ontologies within the common genes using the cellular component function in PANTHER uncovered significantly enriched ontologies related to the centrosome, as represented by PCNT/Plp, CEP192/spd-2 and PLK1/polo mRNAs (Fig. S1, Table S2) (Mi et al., 2021). In accordance, recent work shows that CPEB1 is required for the translation and recruitment of Polo-like kinase (PLK1) to centrosomes (Pascual et al., 2021). Here, we focused our subsequent analysis on PLP.
Most Orb targets contain a CPE consensus motif (e.g. UUUUAU/U or UUUUAAU) in their 3′-UTR (Fox et al., 1989; McGrew and Richter, 1990; Stepien et al., 2016), although CPEB proteins can also recognize non-canonical CPE motifs [e.g. UUUUACU or UUUUAAGU (Piqué et al., 2008) or UUUUAA (Barkoff et al., 2000) or UUUUGU (Stepien et al., 2016)]. As a first step of validating Plp mRNA as an Orb target, we identified two consensus CPE motifs within the Plp 3′UTR (Fig. 2B, red boxes). Next, we aligned the Plp 3′-UTR across multiple Drosophila species using the conservation insect track on the UCSC genome browser and found that these CPE motifs were conserved across millions of years of evolutionary distance (Fig. 2B; Kent et al., 2002). Finally, we aligned Drosophila melanogaster Plp and human PCNT 3′UTRs using Clustal Omega (Madeira et al., 2019). Plp transcripts utilize one of two different 3′-UTRs varying in length: a short 3′-UTR (431 nt) or a long 3′-UTR (591 nt) (Graveley et al., 2011). The short Plp 3′-UTR has 100% identity with the long Plp 3′-UTR and 44.6% identity with the PCNT 3′-UTR, whereas the long Plp 3′-UTR has 46.9% identity with the PCNT 3′-UTR. All three 3′-UTRs contain two consensus CPE motifs (Fig. 2B, red boxes). Conservation of CPE sites within the Plp 3′UTR indicates that they are likely to be biologically relevant.
The context of CPE sites is also important for their function. To support formation of the polyadenylation complex, CPE sites are typically situated within 100 nt from the hexanucleotide AAUAAA motif recognized by the cleavage and polyadenylation specificity factor (CPSF) complex (Mendez et al., 2000b). The second CPE motif located within the Plp 3′UTR is proximal to a CPSF motif (Fig. 2B, green boxes), suggestive of a role in translational control.
To investigate whether Orb associates with Plp mRNA during early development, we used a GFP-Orb gene trap, which inserts gfp coding sequences at the endogenous orb locus (Nagarkar-Jaiswal et al., 2015), to affinity purify interacting mRNAs by RT-PCR. Similar to endogenous orb expression, we detected GFP-Orb more readily in ovaries compared with embryos (Lantz et al., 1992, 1994; Rangan et al., 2009; Hafer et al., 2011) (Fig. S2A,B). Using GFP-Orb ovarian extracts, we confirmed that Orb associates with orb mRNA, consistent with prior work (Tan et al., 2001), which also demonstrates that the Orb fusion protein is competent to bind mRNA targets (Fig. 2C). We also detected a ∼7.5-fold enrichment of Plp mRNA in GFP-Orb immunoprecipitated samples over the WT control. In contrast, the negative control, Gapdh1 mRNA, was not pulled down (Fig. 2C). We conclude that Plp mRNA associates biochemically with Orb during early development.
Orb is dispensable for Plp mRNA localization
To examine whether Orb contributes to Plp mRNA localization to centrosomes, we compared Plp mRNA distributions using smFISH in control versus orb mutant embryos. To examine maternal effects, we harvested embryos from transheterozygous orbF343/orbmel (hereafter, orb) mutant mothers. Whereas orbF343 is a protein null, orbmel is a weak hypomorph (Christerson and McKearin, 1994; Lantz et al., 1994). By western blot, we confirmed that Orb protein expression is reduced in orb mutant ovarian extracts (Fig. S2C,D), consistent with prior work (Christerson and McKearin, 1994; Lantz et al., 1994). At all stages examined, we observed no difference in Plp or Gapdh1 mRNA distributions in controls versus orb NC 10 or NC 12 mutant embryos (Fig. 3). These results indicate that Orb is not required for Plp mRNA localization to centrosomes.
Orb promotes PLP translation
Next, to investigate the contribution of Orb to regulation of PLP protein expression, we performed semi-quantitative western blotting to examine PLP levels in 0- to 2-h-old wild-type (WT) and orb mutant embryos. The Plp gene encodes 12 different protein isoforms varying in predicted molecular weight (MW) from ∼200 to 320 kDa (Graveley et al., 2011). Western blot analysis of 0- to 2-h-old embryonic extracts yielded multiple bands above 250 kDa. Comparing the banding pattern in control versus null Plp2172 mutant germline clones indicated that the band migrating just above 250 kDa is non-specific (asterisks), whereas the upper (caret; upper MW) and middle (arrowhead; mid-MW; Fig. S3A, Fig. 4) bands represent PLP isoforms migrating at different MWs. Consistent with this, multiple PLP isoforms have been detected in larval brains (Galletta et al., 2014). Because multiple PLP isoforms are predicted to migrate around the same MW, e.g. RF, RK, RL, RG, RP and RD migrate ∼320 KDa (caret; Fig. 4A-D), we are unable to distinguish individual isoforms. Instead, we quantified the upper versus mid-MW bands to calculate differences in PLP protein levels.
Quantification of the upper MW bands uncovered a ∼50% reduction in hypomorphic orb mutant embryos compared with WT (Fig. 4A,E). We recently showed that Plp hemizygous embryos (Plp2172/+) also reduce PLP by about 40% (Fang and Lerit, 2020). Therefore, we generated Plp2172, orbF343 recombinant chromosomes and crossed these animals to orbmel mutants to harvest embryos from Plp hemizygous, orb mutant mothers (genotype: Plp2172/+, orbF343/orbmel; hereafter, Plp/+, orb). Quantification shows that simultaneous depletion of Plp and orb within Plp/+, orb mutant embryos results in a ∼75% reduction of upper MW PLP products, suggesting that Orb regulates PLP translation (Fig. 4B,E). The mid-MW PLP isoforms may represent RM, RN and RJ and were similarly downregulated in orb embryos (Fig. 4A,F).
To investigate the specificity of the orb-dependent response on PLP expression, we also examined PLP levels after depleting the other Drosophila CPEB family member, Orb2, and Fragile X Mental Retardation Protein (FMRP; Fmr1), an RNA-binding protein known to share several common mRNA targets with orb (Costa et al., 2005). We note no significant difference in PLP levels in orb2 or Fmr1 null embryos (Fig. 4C-F). These results highlight a specific requirement of Orb to support normal levels of PLP protein, possibly at the level of translational activation.
Orb downregulates Plp mRNA levels
To investigate whether Orb regulates Plp mRNA levels to promote protein expression, we performed qRT-PCR using primers designed to recognize all predicted Plp mRNA variants. We detected a 1.3-fold increase in Plp mRNA in 0- to 2-h-old orb-depleted embryos relative to WT (Fig. S3B). Thus, the reduced levels of PLP protein observed in orb mutants may not be attributed to reduced Plp mRNA transcription or RNA stability.
During the first 2 h of embryogenesis, zygotic transcription is largely inhibited, and RNA is mainly acquired from maternal oocytes (Tadros and Lipshitz, 2009). To test whether the increased Plp mRNA observed in orb embryos might be inherited from oogenesis, we examined Plp mRNA in 2- to 4-day-old ovaries. orb ovarian extracts contained ∼1.4-fold more Plp mRNA than WT, suggesting that Orb normally attenuates Plp mRNA expression or stability and consistent with the idea that elevated levels of Plp mRNA in orb mutants are maintained in the early embryo (Fig. S3C). In contrast, we found that PLP protein levels are unaltered in orb mutant ovarian extracts compared with WT, indicating that Orb-dependent regulation of PLP translation is restricted to embryogenesis (Fig. S3D,E).
Orb facilitates the polyadenylation of Plp mRNA
CPEB proteins, including Orb, mediate translational activation and/or repression by regulating the cytoplasmic polyadenylation of target mRNAs (Chang et al., 1999, 2001; Castagnetti and Ephrussi, 2003; Kim and Richter, 2007; Novoa et al., 2010; Burns et al., 2011; Norvell et al., 2015; Rojas-Ríos et al., 2015). To examine whether Orb regulates Plp mRNA polyadenylation to promote PLP translation, we monitored Plp poly(A) tail length. Among the 12 Plp mRNA variants, only PlpRM uses the long 3′UTR (591 nt). The remaining 11 Plp mRNA variants use a short 3′UTR (431 nt) (Fig. 5A) (Graveley et al., 2011). We first assayed which Plp 3′UTRs are expressed in 0- to 2-h-old embryos by amplifying cDNA using one of two reverse primers: one aligns within a region common to both Plp 3′UTRs (PlpRev1), whereas the other specifically aligns to the long Plp 3′UTR (PlpRev2; Fig. 5A). PCR products corresponding to the Plp 3′UTR were further validated by restriction enzyme digestion (Norvell et al., 2015). Whereas both Plp 3′UTRs are sensitive to BmrI digestion, only the long Plp 3′UTR is sensitive to EcoR1 (Fig. 5A,B, lanes 1-8). Although our PCR profiling confirmed expression of the long 3′UTR associated with PlpRM, qRT-PCR demonstrated that PlpRM represents only ∼5% of total Plp mRNA in 0- to 2-h-old WT embryos (Fig. 5C). Bioinformatic analysis of published RNA-sequencing datasets confirms the lower expression of PlpRM in early embryos (Graveley et al., 2011).
We next performed a poly(A) test (PAT) assay of Plp mRNA from control versus orbF343/orbmel mutant embryos (Legnini et al., 2019). For this, we tagged polyadenylated mRNA from 0- to 2-h-old embryos with guanosine and inosine (G/I-tailing), followed by RT-PCR to synthesize cDNA. Plp poly(A) tails were then amplified by PCR using a universal reverse primer and a Plp-specific forward primer (Fig. 5A). PAT products resolved as a ∼339-525 bp smear by gel electrophoresis (Fig. 5B, lanes 9, 10), corresponding to approximately 14-200 nt poly(A) length (Fig. 5B, arrowheads). Based on the position of our PlpRev1 primer, products below 293 bp [i.e. below 0 nt poly(A) length for the short 3′UTR] likely represent non-specific bands; these were detected in all PAT samples (Fig. 5B, lanes 9-14). We used restriction enzyme digestion to distinguish PAT products from the Plp long versus short 3′-UTRs. As Plp PAT products are sensitive to BmrI digestion, but only modestly altered by EcoRI, we conclude that polyadenylated products from the short Plp 3′UTR are more enriched in 0- to 2-h-old embryos than those from the long Plp 3′-UTR (Fig. 5B, lane 9-14). Plotting a line profile of the PAT products detected in control versus orb embryos reveals a leftward shift indicative of reduced polyadenylation of Plp mRNA in orb mutants (Fig. 5D, solid lines). Similar results were observed in replicated experiments (Fig. S3F,G). To confirm that the short Plp 3′UTR is differentially polyadenylated in controls versus orb mutants, we also examined the profiles of the EcoRI-digested PAT products, which should be enriched for the polyadenylated short Plp 3′UTR. This analysis also revealed a leftward shift (Fig. 5D, dashed lines). Because polyadenylation stimulates translation (Eichhorn et al., 2016; Passmore and Coller, 2021; Xiang and Bartel, 2021), our results are consistent with a model wherein Orb activates Plp mRNA translation by promoting polyadenylation of the short 3′UTR.
Orb regulates PLP-Cnn scaffold organization
In interphase embryos, PLP normally localizes to the centriole and at the tips of extended PCM flares (Lerit et al., 2015; Richens et al., 2015). To investigate whether the depletion of PLP protein observed in orb mutants alters PLP localization to the centrosome, we quantified the intensity of endogenous PLP signals at control versus orb mutant centrosomes in NC 13 embryos. As expected, WT embryos had PLP signals at the centriole and flare zone (Fig. 6A, WT). We generated Plp null mutant germline clone embryos (Plp mutants) and confirmed that PLP is undetectable, validating the specificity of our antibody (Fig. 6A, Plp). In contrast, orb mutants, Plp/+ hemizygotes and recombinant Plp/+, orb mutant embryos showed reduced PLP localization to centrosomes compared with WT (Fig. 6A; orb, Plp/+ and Plp/+, orb). To quantify the relative localization of PLP at centrosomes, we used a custom Python code to batch calculate the total intensity of PLP signals within 2 μm of the centrosome across all genotypes after validating this approach by comparison with manual quantification (Fig. S4A-C). Quantification uncovered a ∼20% reduction of PLP at centrosomes in orb mutants and Plp/+ hemizygotes, which, although not significantly different from WT by one-way ANOVA, trends downward (Fig. 6B). Given that orbmel is a hypomorph, not a null allele, and some functional Orb protein remains in orbF343/orbmel mutants (Fig. S2C), PLP recruitment to centrosomes is likely to be further reduced in the absence of orb activity. Consistent with a requirement for orb in PLP localization, we noted a ∼20% reduction in recombinant Plp/+, orb mutants compared with Plp/+, which also trends lower but was not significantly different by one-way ANOVA (Fig. 6A,B). These data suggest that PLP dosage at centrosomes is sensitive to orb activity.
We reasoned that the apparent reduction in PLP recruitment to centrosomes might be attributed to the reduction in total PLP levels, suggesting that increasing Plp dosage should rescue PLP localization in orb embryos. To test this hypothesis, we expressed in the orb mutant background a functional PLP-GFP transgene capable of rescuing Plp mutant phenotypes (Galletta et al., 2014; Lerit et al., 2015). PLP distribution is restored at PLP-GFP; orb centrosomes, supporting the idea that PLP localization to centrosomes occurs downstream of orb activity (Fig. 6A, B; P<0.05 for PLP-GFP; orb versus orb and P=0.4978 for PLP-GFP; orb versus WT by one-way ANOVA).
Our prior work showed that PLP interacts directly with and organizes Cnn at centrosomes to support PCM scaffolding (Lerit et al., 2015). Given the diminished PLP levels detected in orb mutants, we next assayed Cnn organization. In control embryos, Cnn radiated symmetrically from centrosomes, forming interphase-specific flares, as previously described (Fig. 6C, WT) (Megraw et al., 2002). Consistent with our prior work, Cnn distribution appeared severely disorganized in Plp embryos with Cnn fragments dispersed within the cytosol (Fig. 6C, Plp) (Lerit et al., 2015; Fang and Lerit, 2020). Quantification of the relative number of cytoplasmic Cnn puncta in segmented images showed a significant, nearly 6-fold increase in Plp embryos relative to WT (Fig. 6D; P<0.001 by one-way ANOVA). Similar responses, albeit with reduced magnitude, were also observed in orb and Plp/+, orb mutant embryos (Fig. 6C,D; P<0.01 for orb and P<0.001 for Plp/+, orb versus WT by one-way ANOVA). In contrast, the relative number of cytoplasmic Cnn puncta in Plp/+ hemizygotes trended upward but was not significantly different from WT (Fig. 6C,D; Plp/+). Moreover, expression of the PLP-GFP transgene rescued Cnn organization in orb mutants (Fig. 6C,D; P=0.9662 for PLP-GFP; orb versus WT by one-way ANOVA). Therefore, Orb contributes to proper PLP-Cnn scaffold organization, likely by regulating PLP protein expression and localization.
Orb protein distributes throughout the somatic cytoplasm
As Orb associates with Plp mRNA and potentiates PCM scaffolding, we next ascertained whether endogenous Orb protein localizes near centrosomes. In syncytial blastoderm embryos, Orb signals are enriched within the pole cells at the posterior pole (Lantz et al., 1992; Rangan et al., 2009). In addition, we observed some Orb apposed centrosomes within somatic, mid-embryo regions (Fig. S4D, control). As expected, anti-Orb signals were diminished in hypomorphic orb mutants (Fig. S4D, orbF343/mel). These data suggest that Orb may regulate mRNA targets locally at the centrosome, within the cytoplasm, or both.
Orb-dependent regulation of PLP supports genome stability
A requirement for Orb in modulating PLP levels, localization and activity predicts that loss of orb would compromise centrosome function in maintaining mitotic fidelity. To investigate whether orb depletion is associated with chromosome instability (CIN), we stained WT and orb mutant embryos with DAPI, the mitotic marker pH3 and Asterless (Asl) to label centrioles (Varmark et al., 2007). Upon examination of anaphase embryos, the chromosomes in WT samples completely separated and lagging chromosomes were infrequent (n=3/20 WT embryos with CIN; Fig. 7A,B). In contrast, elevated rates of lagging chromosomes or chromosomal bridges were observed in orb mutants (55%, n=11/20 orb embryos with CIN), represented by lagging chromosomes at the spindle equator with persistent pH3-staining in anaphase/telophase-stage embryos (Fox et al., 2010; Vitre and Cleveland, 2012). Moreover, PLP-GFP expression restored the mitotic fidelity of orb mutant embryos, evident by decreased CIN rates (21%, n=5/24 PLP-GFP; orb embryos with CIN; Fig. 7A,B; P<0.01 for PLP-GFP; orb versus orb and P=0.4995 for PLP-GFP; orb versus WT by χ2 analysis).
To examine further the extent of CIN within individual embryos, we quantified the proportion of nuclei exhibiting CIN from genotype-blinded images. These data confirmed that the frequency of CIN is elevated in orb mutants. Although n=3/20 WT embryos displayed CIN, only one embryo had ∼20% nuclei with CIN; the other two embryos had ∼1% nuclei with CIN. In contrast, most orb mutant embryos had significantly more (5-47%) CIN+ nuclei (P<0.01 for WT versus orb by one-way ANOVA followed by Kruskal–Wallis test; Fig. 7C). PLP-GFP expression significantly alleviated the CIN defects in orb mutants (5-20%; P<0.05 for PLP-GFP; orb versus orb and P>0.9999 for PLP-GFP; orb versus WT by one-way ANOVA followed by Kruskal–Wallis test; Fig. 7C). Taken together, these data indicate a requirement for orb in preserving genome stability by a mechanism dependent upon PLP dosage.
To examine genome stability further, we measured rates of nuclear fallout (NUF), a developmental response to DNA damage in which damaged nuclei are ejected from the syncytial blastoderm cortex and targeted for apoptosis (Sullivan et al., 1993; Rothwell et al., 1998). NUF is readily detected as gaps in the normally uniform monolayer of DAPI-positive nuclei lining the embryonic cortex (Fig. 7D, dashed lines). Although low rates of NUF were apparent even in WT embryos (7%, n=2/30), we observed significantly more NUF in orb mutants (47%, n=17/36; Fig. 7D,E; P<0.001 by χ2 analysis). However, NUF was rescued in orb mutants expressing the PLP-GFP transgene (16%, n=6/36 PLP-GFP; orb embryos with NUF; Fig. 7D,E; P<0.01 for PLP-GFP; orb versus orb and P=0.2152 for PLP-GFP; orb versus WT by χ2 analysis), further supporting the idea that Orb promotes genome stability via PLP.
To examine the mitotic fidelity of orb mutants in greater detail, we examined mitotic progression in live, cycling embryos expressing GFP-γTub to label the centrosomes and H2A-RFP to follow the chromosomes. As we were unable to recover double-balanced orbF343 mutants, for these experiments we employed the weaker transheterozygous combination orbF303/orbmel to deplete Orb (Lantz et al., 1994) (Fig. S2D). Whereas nuclei synchronously divided without NUF in most control embryos (18%, n=2/11 showed NUF; Fig. 8A, Movie 1), about 50% of orbF303/orbmel embryos displayed NUF (N=5/10 showed NUF; Fig. 8B, Movie 2). Consistent with our quantification using fixed samples, expression of the PLP-GFP transgene largely ameliorated NUF in orb mutant embryos (17%, n=1/6 showed NUF; Fig. 8C, Movie 3), supporting a model wherein Orb contributes to centrosome function by regulating PLP.
Disruption of centrosome function impairs genome stability, which typically manifests as elevated rates of embryonic lethality. We conducted hatch-rate analysis to approximate embryonic viability in orb mutants versus controls. Relatively low rates of embryonic lethality were noted in WT embryos, as nearly 90% hatched to first-instar larvae. In contrast to WT and consistent with previous studies (Christerson and McKearin, 1994; Lantz et al., 1994), only 32% of orbF343/orbmel mutants hatched to first-instar larvae (Table 1). Embryonic lethality in orb mutants is largely attributed to the requirement of Orb in establishing the embryonic patterning axes via its role in mediating localization and translation of osk and grk mRNAs (Christerson and McKearin, 1994; Chang et al., 1999, 2001; Castagnetti and Ephrussi, 2003). Interestingly, expression of the PLP-GFP transgene partially restored embryonic viability (53% hatched; P<0.0001, orb versus PLP-GFP; orb by χ2 test) (Table 1), supporting the suggestion that a genetic interaction between orb and Plp is required for viability. Orb further supports embryonic viability by regulating other mRNA targets or protein partners (Chang et al., 2001; Mansfield et al., 2002; Norvell et al., 2015). Nonetheless, our data argue Plp is likely a downstream target subject to Orb regulation and support a model in which Orb activates Plp mRNA translation by promoting polyadenylation. This regulation is crucial for PLP-Cnn scaffold assembly, which is required for centrosome function and viability (Table 1). Our findings highlight that the translational regulation of centrosomal mRNAs is important for centrosome activity and function and indicate that Orb is important for centrosome function.
DISCUSSION
We recently analyzed the distributions of five centrosomal mRNAs, including Plp mRNA, revealing a common cell cycle-dependent enrichment at late interphase centrosomes (Ryder et al., 2020). Our present work extended this analysis, highlighting enrichment of Plp mRNA at centrosomes across syncytial development. One simple model is that centrosomal mRNAs are more likely to localize to interphase centrosomes, which are larger than mitotic centrosomes in syncytial Drosophila embryos (Megraw et al., 2002; Lerit et al., 2015). This model oversimplifies the specificity of RNA localization to centrosomes – relatively few RNAs reside at centrosomes (Lécuyer et al., 2007; Chouaib et al., 2020; Kwon et al., 2021; Safieddine et al., 2021). Moreover, similar interphase/prophase-stage preferential enrichments of centrosomal mRNAs were recently observed in cultured human cells, wherein centrosome size is larger in mitosis (Sepulveda et al., 2018; Safieddine et al., 2021). Collectively, these studies demonstrate that multiple mRNAs across divergent species co-enrich at centrosomes at the same cell cycle phase, suggestive of conserved localization mechanisms (Zein-Sabatto and Lerit, 2021). How RNA localization to centrosomes is executed at the molecular level in a cell cycle-dependent manner is a fascinating question requiring further investigation.
Toward this end, we identified conservation of multiple CPE sites within the Plp and PCNT 3′UTRs. Because CPE-containing mRNAs are enriched at spindle poles and CPEB is required for cyclin B1 mRNA localization (Groisman et al., 2000), we reasoned that CPE sites may contribute to Plp, and possibly PCNT, mRNA localization. Given its established roles in mediating localization of other mRNAs, such as osk and grk, we hypothesized that Orb might contribute to the enrichment of Plp mRNA to centrosomes. Our data do not support this hypothesis. Strong hypomorphic orb mutant embryos did not exhibit disrupted Plp mRNA localization to centrosomes.
In cell culture models, PCNT mRNA localization to the centrosome is puromycin sensitive, suggesting that it is trafficked by a co-translational transport mechanism (Sepulveda et al., 2018; Safieddine et al., 2021). Although orb depletion does not impair Plp mRNA localization to centrosomes, it does reduce multiple PLP isoforms by about 50%, suggesting that RNA localization and translation may be uncoupled. It is feasible that multiple orb-independent mechanisms contribute to Plp mRNA localization to centrosomes. Furthermore, our data show that multiple PLP isoforms are subject to Orb regulation. Whether the various PLP isoforms have different functions or regulatory mechanisms is an interesting topic for future study.
Our data support a model whereby Orb regulates PLP translational activation by facilitating polyadenylation. We identified a conserved hexanucleotide motif (AAUAAA) that is important for translational control just downstream of a CPE motif in the Plp 3′UTR. This proximity is predicted to modulate the extent of polyadenylation and translational activation (Piqué et al., 2008). In many organisms, the first hours of embryogenesis rely upon maternally provided mRNAs and proteins until the maternal-to-zygotic transition activates bulk zygotic transcription (Tadros and Lipshitz, 2009). Consequently, translational regulation is a signature paradigm of gene regulation during early development (Johnstone and Lasko, 2001). Because syncytial Drosophila embryos divide every 10-20 min, they undergo rapid, successive centrosome doubling events and oscillations in PCM recruitment and shedding at compressed timescales. Here, we define a mechanism of translational activation of a conserved PCM scaffolding factor, PLP, mediated by the CPEB family member Orb. Future work is needed to determine whether Orb binds Plp mRNA directly to stimulate local translation of Plp mRNA at centrosomes.
We detected differential usage among two alternative 3′UTRs, showing that the shorter Plp 3′UTR is favored during embryogenesis. Moreover, monitoring poly(A)-tail length revealed reduced polyadenylation at the shorter Plp 3′UTR in orb mutants compared with controls. Genome-wide studies have revealed that mRNA poly(A) length is generally positively correlated with translation efficiency in Drosophila mature oocytes and early embryos (Subtelny et al., 2014; Eichhorn et al., 2016; Lim et al., 2016). Other studies using luciferase reporter systems have also demonstrated that poly(A)-tail length strongly influences translation efficiency (Coll et al., 2010; Xiang and Bartel, 2021). Consistent with this model, the poly(A)-tail length of the Orb target mRNAs, cortex (cort), osk and Atg12 correlate with translational efficiency (Castagnetti and Ephrussi, 2003; Benoit et al., 2008; Rojas-Ríos et al., 2015). Thus, polyadenylation by Orb likely promotes Plp mRNA translation.
The mechanism by which CPEB proteins promote translation is best defined in Xenopus oocytes and embryos; in immature oocytes or during embryonic progression into M phase, CPE-containing mRNAs are translationally repressed in a complex with CPEB and Maskin, an EIF4E-binding protein that inhibits polyadenylation-dependent translation activation (Mendez et al., 2000b; Groisman et al., 2002). When oocyte maturation begins or embryos exit M phase, this inhibition is relieved by CPEB1 phosphorylation, which triggers dissociation of Maskin from EIF4E and recruits CPSF and poly(A) polymerase (PAP) to the 3′UTR of mRNA targets to elongate their poly(A)-tails. The polyadenylated mRNA then recruits and stabilizes interactions with poly(A)-binding protein (PABP) and further recruits eukaryotic translation initiation factors, leading to ribosome assembly and protein translation (Groisman et al., 2000; Mendez et al., 2000b; Mendez and Richter, 2001; Groisman et al., 2002). The requirement of PAP for Orb-dependent polyadenylation of cort mRNA in Drosophila oocytes indicates that mechanisms of CPEB translational regulation are likely conserved (Benoit et al., 2008).
Although PLP protein levels are diminished in orb mutants, PLP localization to centrosomes is more modestly impaired. We detected ∼20% less PLP localizing to interphase centrosomes in NC 13 orb embryos versus ∼50% less PLP protein in embryonic extracts pooled across NC 1 to NC 14. This variance may be attributed to cell cycle or NC-specific dynamics of PLP protein expression or localization. In addition, perdurance of PLP protein at the centrosome may be due to its relatively slow rate of turnover (Conduit et al., 2014; Richens et al., 2015). Moreover, because null orb mutants do not produce embryos (Lantz et al., 1994), we characterized embryonic orb phenotypes in a hypomorphic orbF343/orbmel background, wherein small amounts of functional Orb protein remain. Thus, changes to PLP expression, localization to centrosomes, and associated phenotypes would likely be exacerbated in the complete absence of orb activity. Furthermore, Orb may regulate other mRNAs, such as spd-2 or polo, to enhance PCM recruitment and support centrosome activity. Taken together, our data are consistent with a model whereby Orb-mediated translational activation of Plp mRNA facilitates PLP protein localization to centrosomes (Fig. 8E), although redundant mechanisms likely exist to ensure robust localization, consistent with the integral role PLP plays in PCM scaffolding.
MATERIALS AND METHODS
Fly stocks
The following stocks and transgenic lines were used: y1w1118 [Bloomington Drosophila Stock Center (BDSC) #1495] was used as the WT control unless otherwise noted. The genome reference genotype iso-1 (BDSC #2057) was used as the control for the PAT assay (Brizuela et al., 1994). In all experiments except for live imaging, orb mutant embryos were orbF343/orbmel transheterozygotes [orbF343, BDSC #58477 (Lantz et al., 1994) and orbmel, BDSC #58743 (Christerson and McKearin, 1994)]. For live imaging, orbF303/orbmel transheterozygotes were used (Christerson and McKearin, 1994; Lantz et al., 1994). Null Fmr1 mutant embryos were Fmr1Δ113M/Fmr13 transheterozygotes [Fmr1Δ113M, BDSC #67403; Fmr13, a gift from T. Jongens, University of Pennsylvania, USA (Dockendorff et al., 2002)]. Null orb2 mutant embryos were orb236/orb27 transheterozygotes (orb27, BDSC #58480; orb236, BDSC #58479; Xu et al., 2012); Plp2172 allele is a null allele (Spradling et al., 1999; Martinez-Campos et al., 2004) and was recombined onto the orbF343 chromosome to generate Plp2172, orbF343 recombinant animals. Null Plp mutant germline clones were generated by the FLP/ovoD method using FRT2A, Plp2172 recombinant chromosomes (Chou and Perrimon, 1996; Lerit et al., 2015). Ubi-GFP-γ-Tub23C expresses GFP-γTub under the Ubiquitin (Ubi) promotor (Lerit and Rusan, 2013); Ubi-PLPFL-GFP expresses the full-length PLP isoform PF under the Ubi promoter (Galletta et al., 2014); H2A-RFP expresses a red fluorescent H2A variant under endogenous regulatory elements (Pandey et al., 2005); and GFP-Orb is a gene trap expressing a GFSTF (EGFP, FlAsH, StrepII, TEV and 3xFLAG) tag under endogenous regulatory elements (BDSC #59817; Nagarkar-Jaiswal et al., 2015). To examine maternal effects, mutant embryos were progeny derived from mutant mothers. Flies were raised on Bloomington formula ‘Fly Food B’ (LabExpress), and crosses were maintained at 25°C in a light- and temperature-controlled incubator chamber.
Bioinformatics
To compare overlapping mRNA targets of Orb (Stepien et al., 2016) and CPEB1 (Pascual et al., 2021), Drosophila gene names were converted to human gene identifiers using the of Query symbols/IDs tool in FlyBase (Larkin et al., 2021). Overlapping genes were identified by the ‘COUNT IF’ function in Excel. Venn diagrams were plotted using the Meta-Chart online tool (https://www.meta-chart.com/). Gene ontology cellular component analysis of common genes was analyzed using the Panther statistical over-representation test (http://www.pantherdb.org/), and Fisher's exact test was used to generate an adjusted P-value, i.e. false discovery rate (FDR) (Mi et al., 2021).
To align human PCNT (NCBI; NM_006031.6) and Drosophila Plp 3′UTRs, Clustal Omega was used (Madeira et al., 2019). Conservation of CPE motifs with the Plp 3′UTRs from different Drosophila species was compared using the conservation 124 insect track on the UCSC genome browser (Kent et al., 2002).
Embryonic hatch rate analysis
Eggs (6-12 h) were collected on yeasted grape juice agar plates and ∼200 embryos were transferred to fresh plates and aged for 48 h at 25°C. Unhatched embryos were counted from each plate as a proxy for embryonic lethality, and three independent replicates were performed. Although not directly quantified, we did not observe elevated rates of unfertilized embryos in our orb mutant samples during centrosome structure or mitotic fidelity analyses.
Live imaging
Embryos were prepared for live imaging as described by Lerit et al. (2017). Briefly, dechorionated embryos were adhered to a sticky 22×30 mm #1.5 glass coverslip, covered with a thin layer of halocarbon oil, and inverted onto a clear, gas-permeable 50 mm dish using broken #1 glass coverslips as spacers. Images were captured at 1 μm z-intervals over a 10-15 μm volume at 20 s intervals.
Immunofluorescence
For immunofluorescence with PLP and Cnn antibodies, embryos were fixed in a 1:1 solution of anhydrous methanol (Sigma-Aldrich, 322415):heptane for 15 s and devitellinized in methanol. For smFISH and immunofluorescence staining with Asl and pH3 antibodies, embryos were fixed in a 1:4 solution of 4% paraformaldehyde:heptane for 20 min and devitellinized in methanol (Rothwell and Sullivan, 2007). Fixed embryos were rehydrated, blocked in BBT buffer [PBS supplemented with 0.1% Tween-20 and 0.1% bovine serum albumin (BSA)], and incubated overnight at 4°C with primary antibodies diluted in BBT. For Asl staining, BBT buffer with 0.5% BSA was used. After washing, embryos were further blocked in BBT supplemented with 2% normal goat serum and incubated for 2 h at room temperature with secondary antibodies and DAPI (10 ng/ml, Thermo Fisher Scientific). Embryos were mounted in Aqua-Poly/Mount (Polysciences) prior to imaging.
The following primary antibodies were used: rabbit anti-PLP antibody (1:4000, gift from N. Rusan, National Institutes of Health), guinea pig anti-Asl (1:4000, gift from G. Rogers, University of Arizona, USA), rabbit anti-Cnn (1:4000, gift from T. Megraw, Florida State University, USA), mouse anti-phospho-Histone H3 Ser10 (pH3; 1:1000, Millipore 05570) and mouse anti-Orb [1:10; Developmental Studies Hybridoma Bank (DSHB) 6H4; P. Schedl, Princeton University, USA). Alexa Fluor 488-, 568- or 647- secondary antibodies were used (1:500, Molecular Probes) (see Table S3).
smFISH detection and analysis
Stellaris Plp and Gapdh1 smFISH probes conjugated to Quasar 570 dye (LGC Biosearch Technologies, UK) were designed against the coding region for each gene using the Stellaris RNA FISH probe designer (Ryder et al., 2020; Ryder and Lerit, 2020). smFISH probes were dissolved in nuclease-free water at 25 μM and stored at −20°C before use.
smFISH experiments were performed as previously described (Ryder et al., 2020; Ryder and Lerit, 2020). All the following steps were performed with RNase-free solutions. Embryos were rehydrated and washed first in 0.1% PBST (PBS plus 0.1% Tween-20) and then in wash buffer (WB; 10% formamide and 2× SSC supplemented fresh each experiment with 0.1% Tween-20 and 2 μg/ml nuclease-free BSA). Embryos were then incubated with 100 μl of hybridization buffer [HB; 100 mg/ml dextran sulfate and 10% formamide in 2× SSC supplemented fresh each experiment with 0.1% Tween-20, 2 μg/ml nuclease-free BSA and 10 mM ribonucleoside vanadyl complex (RVC; S1402S; New England Biolabs)] for 10-20 min in a 37°C water bath. Embryos were then incubated in 25 μl of HB containing 0.5 μM smFISH probes in a 37°C water bath overnight. Embryos were washed three times for 30 min in prewarmed WB, stained with DAPI (1:1000) for 1 h at room temperature, washed with 0.1% PBST, and mounted with Vectashield mounting medium (H-1000; Vector Laboratories). Slides were stored at 4°C and imaged within 1 week.
smFISH signals were detected and single-molecule normalization was performed as recently described (Ryder et al., 2020; Ryder and Lerit, 2020). Briefly, single-channel .tif raw images were segmented in three dimensions using Python scripts adapted from the Allen Institute for Cell Science Cell Segmenter (Chen et al., 2018 preprint). Each segmented image was compared with the raw image to validate accurate segmentation. RNA objects of ≥50 pixels in segmented images were identified, and object features were extracted, which included surface coordinates. Distances were measured from the surface of each RNA object to the surface of the closest centrosome. We calculated the percentage of total RNA at 0 μm from the centrosome surface and selected 10, 8, 6 and 4 μm as the upper boundaries for the pseudo-cell radius for NC 10, NC 11, NC 12 and NC 13, respectively, based on measuring the centrosome-to-centrosome distances from a set of representative images. Later interphase/prophase embryos were selected by their large, round nuclei and metaphase samples were identified by alignment of condensed chromosomes at the metaphase plate.
Microscopy
Images were acquired on a Nikon Ti-E system fitted with a Yokagawa CSU-X1 spinning disk head, Hamamatsu Orca Flash 4.0 v2 digital complementary metal oxide-semiconductor (CMOS) camera, Perfect Focus system (Nikon), Nikon LU-N4 solid state laser launch (15 mW; 405, 488, 561 and 647 nm) using a Nikon 100×, 1.49 NA Apo TIRF oil-immersion objective. The microscope was powered through Nikon Elements AR software on a 64-bit HP Z440 workstation.
Image analysis
Fiji (National Institutes of Health; Schindelin et al., 2012) was used for all image analysis. To examine nuclear fallout, embryos were stained with anti-Asl antibody to label centrosomes and DAPI to label DNA (Lerit et al., 2015). Areas where centrosomes clustered but were devoid of nuclei were counted as sites of nuclear fallout from genotype-blinded images. To examine CIN, embryos were stained with anti-Asl to label centrosomes, anti-pH3 to label anaphase-lagging chromosomes, and DAPI to label DNA. Anaphase-stage embryos were scored for lagging chromosomes from genotype-blinded images, as defined by laggard chromosome(s) at the spindle equator showing persistent pH3 staining (Fox et al., 2010).
To quantify PLP localization to centrosomes, single-channel PLP .tif raw images were processed as a batch across all genotypes. Blinded images were segmented in three dimensions to display all PLP objects (as segmentation 1), including centriolar and flare zone signals, using Python scripts adapted from the Allen Institute for Cell Science Cell Segmenter (Chen et al., 2018preprint). Each segmented image was compared with the original image to validate accurate segmentation. A second segmentation was performed in order to display only the PLP objects at centrioles (as segmentation 2), and was used as a reference point to identify all PLP objects (segmentation 1) within a centrosome (segmentation 2). Next, all PLP objects were identified, and the raw image total pixel intensity was extracted from a 2 μm region to calculate the intensity of all PLP objects at the centrosome. To validate the accuracy of batch-analysis for PLP quantification, we compared background-subtracted PLP intensity measurements (integrated densities) within 2 μm of the centrosome from n=10 maximum-intensity projected NC 13 WT and recombinant Plp/+, orb embryos using manual quantification. Similar results were obtained (Fig. S4), and batch analysis was used subsequently (Fig. 6).
To quantify the number of Cnn fragments per pseudo-cell, single-channel Cnn .tif raw images were segmented as described above. We then used the 3D Objects Counter tool in Fiji to quantify the total number of Cnn fragments in the segmented images, which was then averaged by the total number of nuclei.
Plot profiles of overlapping Plp mRNA and GFP-PLP signals were generated using the Plot Profile tool in ImageJ with a single-pixel-wide, 1-μm-long line. Intensities were normalized to the peak fluorescence intensity for each channel and distances were normalized to the peak fluorescence intensity of Plp mRNA.
Images were assembled using Fiji, Adobe Photoshop and Adobe Illustrator software to separate or merge channels, crop regions of interest, generate maximum-intensity projections, and adjust brightness and contrast.
RNA immunoprecipitation
RNA immunoprecipitation was performed as previously described (Ryder et al., 2020). Briefly, ovaries were dissected from ∼20 well-fed females and homogenized on ice in 200 μl lysis buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 2.5 mM MgCl2, 250 mM sucrose and 0.1% Triton X-100) supplemented with 1× EDTA-free protease inhibitor cocktail (Roche, 04693159001), 1 µg/ml Pepstatin A (Sigma-Aldrich, P5318), 1 mM DTT (Sigma-Aldrich, 10197777001), 1 U/μl RNase inhibitor (M0314S; New England Biolabs) and 2 mM RVC. Lysates were cleared by centrifugation at 12,000 rpm (13,523 g), and the supernatant was precleared in 20 μl binding control magnetic beads (bmp-20, ChromoTek) for 30 min at 4°C. Precleared supernatant was then immunoprecipitated with GFP-Trap magnetic agarose beads (gtma-10, ChromoTek) for 2 h at 4°C. Beads were then washed in lysis buffer supplemented with 0.4 mM RVC and resuspended in 100 μl lysis buffer. Twenty-five microliters of bead slurry was reserved and analyzed for protein content by western blotting. RNA was extracted from the remaining 75 μl of beads TRIzol Reagent (15596026, Thermo Fisher Scientific) following treatment with 1 μl TURBO Dnase (AM1907; Thermo Fisher Scientific).
cDNA was synthesized from 500 ng of RNA using Superscript IV Reverse Transcriptase (18091050; Thermo Fisher Scientific) according to the manufacturer's protocol. DNA was amplified by PCR using Phusion High Fidelity DNA Polymerase (M0530L; New England Biolabs) using the following primers: Plp Forward, GAAGCCATATCGAAGACACTC; Plp Reverse, TGTCAGCCAATAGTCAGTCG; Gapdh1 Forward, CACCCATTCGTCTGTGTTCG; Gapdh1 Reverse, CAACAGTGATTCCCGACCAG; orb Forward, GTGTGAGACTTTGGACTTGTAGG; orb Reverse, GTTTCGATTCGAGGGTGTTCG.
Immunoblotting
Embryo extracts were prepared from ∼10 μl of methanol-fixed embryos. Embryos were rehydrated with 0.1% PBST and homogenized in 150 μl 0.1% PBST using a disposable plastic pestle and cordless motor. Ovarian extracts were similarly prepared from ovaries dissected from ten well-fed females. Thirty microliters of 5× SDS loading buffer was added into the protein extracts, and the samples were boiled at 95°C for 10 min. Extracts were stored at −20°C or immediately resolved on an 7.5% SDS-PAGE pre-cast gel (Bio-Rad, 4568023) and transferred onto a 0.2 μm nitrocellulose membrane (GE Healthcare, 10600001) by wet-transfer in a buffer containing 25 mM Tris-HCl, pH 7.6, 192 mM glycine, 10% methanol and 0.02% SDS. Membranes were blocked for 1 h at room temperature in 5% dry milk diluted in TBST (Tris-based saline with 0.05% Tween-20), washed well with TBST, and incubated overnight at 4°C with primary antibodies. After washing with TBST, membranes were incubated for 1.5 h in secondary antibodies diluted 1:5000 in TBST. Bands were visualized with Clarity ECL substrate (Bio-Rad, 1705061) on a Bio-Rad ChemiDoc imaging system.
The following primary antibodies were used: rabbit anti-PLP (1:4000, gift from N. Rusan, National Institutes of Health), mouse anti-Khc SUK 4 (1:200, DSHB; J. M. Scholey, University of Colorado, USA), guinea pig anti-Asl (1:10,000, gift from G. Rogers, University of Arizona, USA), mouse anti-β-Tubulin E7 (1:1000, DSHB; M. Klymkowsky, University of Colorado, USA), mouse anti-Orb 4H8 (1:100, DHSB; P. Schedl, Princeton University, USA). Secondary antibody was goat anti-mouse HRP (1:5000, Thermo Fisher Scientific, 31430). Densitometry was measured in Adobe Photoshop and protein levels were normalized to the loading control.
qRT-PCR
RNA was extracted from ∼2-5 mg of dechorionated 0- to 2 h-old embryos or ovaries dissected from five well-fed females per biological replicate using TRIzol Reagent (15596026, Thermo Fisher Scientific) and treated with1 μl TURBO Dnase (2 U/μl, AM1907, Thermo Fisher Scientific) prior to RT-PCR. Five-hundred nanograms of RNA was reverse transcribed to cDNA with Superscript IV Reverse Transcriptase following the manufacturer's protocol. qPCR was performed on a Bio-Rad CFX96 Real-time system with iTaq Universal SYBR Green Supermix (1725121, Bio-Rad). Values were normalized to RpL32 (rp49) expression levels. Ct values from the qPCR results were analyzed and the relative expression levels for each condition were calculated using Microsoft Excel. Three biological replicates and three technical replicates were performed on a single 96-well plate.
The primers used in this study were: rp49 Forward, CATACAGGCCCAAGATCGTG; rp49 Reverse, ACAGCTTAGCATATCGATCCG; Plp Forward, CGCAGCAAGGAGGAGATAAC; Plp Reverse, TCAGCCTGCAGTTTGTTCAC; PlpRM Forward, TGTCCCAGTATTTTGATTGGT; PlpRM Reverse, GTCCAGTGAATTCTCACCCT.
PAT assay
Two micrograms of 0- to 2-h-old embryos were harvested and RNA was extracted with TRIzol Reagent (15596026, Thermo Fisher Scientific). The PAT test was conducted following the manufacturer's protocol (Thermo Fisher Scientific, PAT kit, 76455). Briefly, 3 μg of RNA was digested with Turbo dNase (2 U/μl, AM1907, Thermo Fisher Scientific), then 500 ng of dNase-digested RNA was tagged with G/I tails in a 10 μl reaction, and 5 μl of G/I-tailed RNAs were reverse transcribed using a universal primer complementary to the G/I tails to synthesize cDNA in a 20 μl reaction. Twenty microliters of cDNA was diluted 1:1 into nuclease-free water, and 10 μl was then used to amplify PAT products using a Plp-specific forward primer and a universal reverse primer complementary to the G/I tails in a 50 μl reaction using a two-step PCR protocol and Taq polymerase, as provided by the manufacturer. To amplify long or short Plp 3′-UTRs, 2 μl of diluted cDNA was used as template using the indicated primers in a 50 μl reaction using Phusion High Fidelity DNA Polymerase (M0530L; New England Biolabs). Fifteen microliters of amplified DNA was used for EcoRI and BmrI restriction enzyme digestion (New England Biolabs). DNA products were separated by gel electrophoresis on a 3% agarose gel. The primer PATRev was part of the PAT kit and is proprietary to the manufacturer. The primers we designed that were used in this study were: PlpRev1, CGAATGTGAAATAAATTTGGTT; PlpRev2, CTACTGCTTTCGATACCTTTTT; PlpFw, ACCTGTACCATTTCCCCTCA.
Statistical methods
Data were plotted and statistical analysis was performed using GraphPad Prism software. To calculate significance, distribution normality was first confirmed with a D'Agnostino and Pearson normality test. Data were then analyzed by unpaired t-test or one-way ANOVA test or a χ2 test and are displayed as mean±s.d. Data shown are representative results from at least two independent experiments.
Acknowledgements
We thank Drs Nasser Rusan, Greg Rogers and Timothy Megraw for gifts of reagents; Drs Elizabeth Gavis, Amanda Norvell and Martine Simonelig for advice about the PAT assay; Dr Pearl Ryder for computational assistance; Ms Beverly Robinson for technical advice on ontological analysis; and Mr Jovan Brockett for embryo collections. We are grateful to Drs Paul Schedl, Gary Bassell and Guohong Li for constructive feedback on the manuscript.
Footnotes
Author contributions
Conceptualization: D.A.L.; Methodology: J.F.; Software: J.F.; Validation: J.F.; Formal analysis: J.F.; Investigation: J.F.; Writing - original draft: J.F., D.A.L.; Writing - review & editing: J.F., D.A.L.; Visualization: J.F.; Supervision: D.A.L.; Project administration: J.F., D.A.L.; Funding acquisition: J.F., D.A.L.
Funding
This work was supported by the National Institutes of Health [R01GM138544 to D.A.L. and K99GM143517 to J.F.] and the American Heart Association [20POST35210023 to J.F.]. Deposited in PMC for release after 12 months.
Data availability
Uncropped gels and blots are available to view on Figshare: https://doi.org/10.6084/m9.figshare.16900417.v1; https://doi.org/10.6084/m9.figshare.16900423.v1; https://doi.org/10.6084/m9.figshare.16900471.v4; https://doi.org/10.6084/m9.figshare.16900429.v4.
Peer review history
The peer review history is available online at https://journals.biologists.com/dev/article-lookup/doi/10.1242/dev.200426.
References
Competing interests
The authors declare no competing or financial interests.