There were errors in Development (2019) 146, dev179572 (doi:10.1242/dev.179572).
In the supplementary information, the primer sequences for sox9a in Table S1 were not correct.
Corrected:
sox9a forward primer (5′→3′), GTCTGATGCACCCAGTCCG; sox9a reverse primer (5′→3′), TCCTTCTTGAAGTCTCCGAGC.
Original:
sox9a forward primer (5′→3′), AGTCCACACGTTTCCTGATTG; sox9a reverse primer (5′→3′), ATCCTGTGGAATTCTGTGACG.
The online supplementary PDF has been updated.
The authors apologise to readers for this error and for any inconvenience it may have caused.
© 2020. Published by The Company of Biologists Ltd
2020
