Lysophosphatidic acid (LPA) has wide-ranging effects on many different cell types, acting through G-protein-coupled receptors such as LPAR6. We show that Xenopus lpar6 is expressed from late blastulae and is enriched in the mesoderm and dorsal ectoderm of early gastrulae. Expression in gastrulae is an early response to FGF signalling. Transcripts for lpar6 are enriched in the neural plate of Xenopus neurulae and loss of function caused forebrain defects, with reduced expression of telencephalic markers (foxg1, emx1 and nkx2-1). Midbrain (en2) and hindbrain (egr2) markers were unaffected. Foxg1 expression requires LPAR6 within ectoderm and not mesoderm. Head defects caused by LPAR6 loss of function were enhanced by co-inhibiting FGF signalling, with defects extending into the hindbrain (en2 and egr2 expression reduced). This is more severe than expected from simple summation of individual defects, suggesting that LPAR6 and FGF have overlapping or partially redundant functions in the anterior neural plate. We observed similar defects in forebrain development in loss-of-function experiments for ENPP2, an enzyme involved in the synthesis of extracellular LPA. Our study demonstrates a role for LPA in early forebrain development.

Lysophosphatidic acid (LPA) is a small ubiquitous phospholipid that acts as an extracellular signal and is believed to be involved in numerous physiological and pathological processes. It evokes a wide range of cellular responses from different cell types, including effects on cell proliferation, migration, adhesion, shape changes and death (Noguchi et al., 2009; Skoura and Hla, 2009; Choi et al., 2010). These diverse cellular functions are mediated by at least six members of the large superfamily of G-protein-coupled receptors (GPCR): LPA receptors 1 to 3 (LPAR1-3) belong to the Endothelial differentiation gene (EDG) subgroup, which also includes receptors for the bioactive lipid Sphingosine-1-phosphate, whereas LPA receptors 4 to 6 (LPAR4-6) belong to the Purinergic receptor (P2Y) subgroup, which includes receptors for extracellular Adenosine triphosphate (ATP) and Uridine triphosphate (UTP) (Choi et al., 2010). All six receptors couple to multiple G-protein subtypes that regulate multiple intracellular signalling pathways, including Cyclic adenosine monophosphate (cAMP), Ca2+, Mitogen-activated protein (MAP) kinase, and Rho GTPases.

LPA receptors are widely expressed in vertebrate embryos, with distinct but overlapping expression patterns (Ohuchi et al., 2008; Massé et al., 2010a). Several LPA receptors are expressed in the developing nervous system (Ohuchi et al., 2008) but loss-of-function studies have provided few clues as to their role in neural development. Only minor phenotypic changes are observed, which presumably reflects redundant functions among LPA receptors (Contos et al., 2000; Contos et al., 2002; Ye et al., 2005; Lee et al., 2008). Abnormalities have been described in the cerebral cortex of Lpar1-/- mutant mice, including a reduction in neuronal progenitors (Estivill-Torrús et al., 2008) - a phenotype consistent with Lpar1 expression in the ventricular zone of the developing cortex (Hecht et al., 1996). Lpar5 is strongly expressed in a subset of neurons in dorsal root ganglia and loss-of-function studies have indicated a role in neuropathic pain (Lin et al., 2012). Severe neural defects have also been described in embryos lacking Ectonucleotide pyrophosphatase/phosphodiesterase 2 (ENPP2; also known as Autotaxin and Lysophospholipase D), a secreted enzyme involved in the synthesis of extracellular LPA (Tokumura et al., 2002; Umezu-Goto et al., 2002). Enpp2-/- mutant mice fail to complete cranial neural tube closure and exhibit defects in the forebrain and at the midbrain-hindbrain boundary (MHB) (Fotopoulou et al., 2010; Koike et al., 2010; Koike et al., 2011).

LPAR6 is the most recently characterised member of the family of LPA receptors (Chun et al., 2010). Identified as an orphan GPCR (Kaplan et al., 1993), it was subsequently named P2Y5 because of homology to nucleotide receptors (Webb et al., 1996). However, it failed to elicit detectable responses to extracellular nucleotides (Li et al., 1997). More recently, LPAR6 was shown to be a receptor for LPA, activating Gαi and Gα12/13 G proteins, inhibiting Adenylyl cyclase, phosphorylating ERK1/2, and activating Rho GTPase (Pasternack et al., 2008; Lee et al., 2009; Pasternack et al., 2009; Yanagida et al., 2009). Little is known about the role of LPAR6 in cellular physiology except that it is required for human hair growth (Pasternack et al., 2008; Shimomura et al., 2008; Pasternack et al., 2009; Shimomura et al., 2009a). LPAR6 is expressed in the inner root sheath of hair follicles (Pasternack et al., 2008; Shimomura et al., 2008) and loss-of-function mutations in this receptor are found in families with autosomal hair defects (Pasternack et al., 2008; Pasternack et al., 2009; Shimomura et al., 2008). Similar hair defects have been observed in families carrying loss-of-function mutations in the Lipase H (LIPH) gene, which is also expressed in the inner root sheath of hair follicles and encodes a secreted enzyme involved in the synthesis of extracellular LPA (Kazantseva et al., 2006; Shimomura et al., 2009b). However, both LPAR6 and LIPH are widely expressed in human tissues, indicating that they have multiple roles.

In this study, we show that lpar6 is expressed in Xenopus embryos, from late blastulae through to tadpoles, and that loss of function disrupts neural development. Embryos injected with antisense morpholinos (AMO) to lpar6 had greatly reduced expression of telencephalic markers (foxg1, emx1 and nkx2-1) and reduced expression of eyefield markers (rax and pax6). Midbrain (en2) and hindbrain (egr2) markers were not affected, demonstrating that defects were restricted to the developing forebrain. Foxg1 expression requires LPAR6 within the ectoderm and not the mesoderm. Remarkably, defects caused by injecting lpar6-AMO were enhanced by also inhibiting FGF signalling, with midbrain (en2) and hindbrain (egr2) markers being greatly reduced in these embryos. This suggests that LPAR6 and FGF signalling interact in anterior neural development. Finally, we show that an AMO targeting Xenopus ENPP2 causes similar defects to those of lpar6-AMO. Our study indicates that LPA signalling is required to specifying cell fates in the anterior nervous system, a role that may involve cooperation with FGF signalling.

Lpar6 is expressed during embryonic development

Scanning expressed sequence tag (EST) databases, we identified Xenopus cDNAs encoding a protein of 345 amino acids, sharing 78% identity with human LPAR6 and only 15-51% identity with human LPAR1-5 (supplementary material Fig. S1). The corresponding gene is nested within the largest intron of the Xenopus rb1 gene and transcribed in the opposite direction (supplementary material Fig. S2), an identical arrangement to that of human LPAR6 and RB1 (Herzog et al., 1996). Sequence conservation and genomic synteny demonstrate that we have identified Xenopus lpar6.

To determine whether lpar6 is expressed during embryonic development we performed reverse transcription polymerase chain reaction (RT-PCR) on staged Xenopus embryos (Fig. 1A). Transcripts were detected from early gastrula (stage 10) through to tadpoles (stage 40), with reduced expression in late gastrulae (stage 13). Microarrays (Branney et al., 2009) showed that lpar6 was transcribed from late blastulae (stage 9), on a similar timescale to fgf8 but preceded the FGF target genes bra and cdx4 (Fig. 1B). RT-PCR found that lpar6 expression was greatest in the marginal zone of early gastrulae, with a low level of expression in the animal hemisphere and no expression in the vegetal hemisphere (Fig. 1C). Whole-mount in situ hybridisation confirmed that lpar6 is expressed in the marginal zone of early gastrulae, with strongest expression above the dorsal blastopore lip (Fig. 2A-C). A bisected embryo shows that expression is localised to the involuting mesoderm (Fig. 2B). We also observed expression in the dorsal-animal hemisphere, the prospective neural plate, of early gastrulae (Fig. 2D). In neurulae, lpar6 is expressed in the neural plate, with strongest expression in anterior regions (Fig. 2E-H). At tailbud stages, lpar6 expression is strongest in the head, branchial arches, notochord and myotome (Fig. 2I,J).

Fig. 1.

Temporal expression of lpar6. (A) RT-PCR analysis for lpar6 and ornithine decarboxylase (odc) in staged Xenopus embryos, showing lpar6 expression from stage 10 (early gastrula) to stage 40 (tadpole). Note the drop in expression at stage 13 (late gastrula). Minus reverse transcriptase control (-RT) was performed at stage 40. (B) Microarray analysis for expression of lpar6, fgf8, bra, cdx4 and a marker for the mid-blastula transition (MBT). Xenopus embryos were collected 0-16 hours post-fertilisation (23°C). (C) RT-PCR analysis for lpar6 and odc in dissected stage 10 embryos. AP, animal pole; DM, dorsal marginal zone; VM, ventral marginal zone; VP, vegetal pole.

Fig. 1.

Temporal expression of lpar6. (A) RT-PCR analysis for lpar6 and ornithine decarboxylase (odc) in staged Xenopus embryos, showing lpar6 expression from stage 10 (early gastrula) to stage 40 (tadpole). Note the drop in expression at stage 13 (late gastrula). Minus reverse transcriptase control (-RT) was performed at stage 40. (B) Microarray analysis for expression of lpar6, fgf8, bra, cdx4 and a marker for the mid-blastula transition (MBT). Xenopus embryos were collected 0-16 hours post-fertilisation (23°C). (C) RT-PCR analysis for lpar6 and odc in dissected stage 10 embryos. AP, animal pole; DM, dorsal marginal zone; VM, ventral marginal zone; VP, vegetal pole.

Fig. 2.

Spatial expression of lpar6. Whole-mount in situ hybridisation with antisense probe for lapr6. (A) Stage 10, vegetal view, with dorsal blastopore lip (arrowhead). (B) Stage 10, bisected, with dorsal blastopore lip (arrowhead). (C) Stage 10.5, vegetal view. (D) Stage 10.5, lateral view, with dorsal-animal expression (arrowhead). (E) Stage 16, anterior view. (F) Stage 19, anterior view. (G) Stage 24, lateral view with head to the left. (H) Stage 16, dorsal view with head to the left. (I) Stage 28, lateral view with head to the left. (J) Stage 28, trunk section. Scale bars: 200 μm. AP, animal pole; BA, branchial arch; Fb, forebrain; Not, notochord; NS, nervous system; VP, vegetal pole.

Fig. 2.

Spatial expression of lpar6. Whole-mount in situ hybridisation with antisense probe for lapr6. (A) Stage 10, vegetal view, with dorsal blastopore lip (arrowhead). (B) Stage 10, bisected, with dorsal blastopore lip (arrowhead). (C) Stage 10.5, vegetal view. (D) Stage 10.5, lateral view, with dorsal-animal expression (arrowhead). (E) Stage 16, anterior view. (F) Stage 19, anterior view. (G) Stage 24, lateral view with head to the left. (H) Stage 16, dorsal view with head to the left. (I) Stage 28, lateral view with head to the left. (J) Stage 28, trunk section. Scale bars: 200 μm. AP, animal pole; BA, branchial arch; Fb, forebrain; Not, notochord; NS, nervous system; VP, vegetal pole.

Lpar6 is a direct target of FGF signalling

Lpar6 was previously shown to be positively regulated by FGF signalling (Branney et al., 2009), with expression levels 60-80% lower in gastrulae expressing dominant-negative FGF receptors (Fig. 3A). To confirm this, we isolated animal caps from blastulae (stage 8) and incubated them in media containing FGF4. RT-PCR showed that FGF4-induced expression of lpar6, consistent with the microarray data (Fig. 3B). Lpar6 expression was also induced by Activin (Fig. 3B), a mesoderm-inducing factor belonging to the TGF-β family (Smith et al., 1990). To determine whether lpar6 induction is an immediate-early response to FGF signalling, we incubated animal caps in media containing both FGF4 and cycloheximide (a protein synthesis inhibitor). However, cycloheximide alone induced strong expression of lpar6 in animal caps (data not shown), replicating the effect previously described for chick lpar6 in cultured spleen cells (Kaplan et al., 1993). As an alternative, we sought to determine how quickly induction of lpar6 transcription occurs in response to FGF signalling. Animal caps were incubated in media containing FGF4, then removed at different time points and analysed by RT-PCR for lpar6 transcripts. We detected weak expression of lpar6 after 30 minutes of FGF4 exposure, with stronger expression after 60 minutes (Fig. 3C). Our results show that transcription of lpar6 is an early response to FGF signalling.

Fig. 3.

FGF regulates expression of lpar6. (A) Microarray analysis for lpar6 transcripts in early gastrulae expressing dnFGFR1 or dnFGFR4. (B) RT-PCR analysis for lpar6 and odc in animal caps incubated for 5 hours (18°C) with either FGF4 or Activin. Sibling embryos were used for embryo and -RT controls. (C) RT-PCR analysis for lpar6 and odc in animal caps incubated with FGF4 for up to 180 minutes (18°C). Sibling embryos were used for whole embryo and -RT controls.

Fig. 3.

FGF regulates expression of lpar6. (A) Microarray analysis for lpar6 transcripts in early gastrulae expressing dnFGFR1 or dnFGFR4. (B) RT-PCR analysis for lpar6 and odc in animal caps incubated for 5 hours (18°C) with either FGF4 or Activin. Sibling embryos were used for embryo and -RT controls. (C) RT-PCR analysis for lpar6 and odc in animal caps incubated with FGF4 for up to 180 minutes (18°C). Sibling embryos were used for whole embryo and -RT controls.

Inhibition of LPAR6 disrupts head development

To determine the role of LPAR6 during development we adopted a loss-of-function approach, using antisense morpholino oligonucleotides (AMO1 and AMO2) that inhibit translation of Xenopus lpar6 (Fig. 4A,B). Xenopus embryos were injected at the two-cell stage with 20 ng per blastomere of either AMO1 or AMO2 and the embryos were examined for developmental defects. Neither AMO had any effect on mesoderm formation in early gastrulae (supplementary material Fig. S3). The first defects were observed at early tailbud stages, with stage 28 embryos displaying a reduced anteroposterior axis length (3.4 mm compared with control length of 4.0 mm, t-test P<0.005) and head defects (Fig. 4C-E). Whole-mount in situ hybridisation showed that both AMO reduced telencephalic expression of foxg1 (Fig. 4F-H). The frequency and severity of head defects were always greater with AMO2, which was used in all subsequent experiments. To demonstrate specificity, we attempted to rescue the head defect by co-injecting 40 ng of AMO2 with human LPAR6 mRNA. Translation of this mRNA is not inhibited by AMO2 (Fig. 4B). Embryos co-injected with 200 pg of LPAR6 mRNA failed to rescue the head defect and embryos injected with 600-800 pg usually died as gastrulae. In two experiments, embryos injected with 400 pg of LPAR6 mRNA survived gastrulation and formed tailbud embryos with a normal head (Fig. 4I-K). We also injected Xenopus tropicalis embryos with a species-specific AMO for lpar6 and obtained tadpoles with a smaller head and reduced foxg1 expression (supplementary material Fig. S4). Our results suggest that forebrain defects are caused by specific inhibition of LPAR6 function.

Fig. 4.

LPAR6 is required for forebrain development. (A) Sequence (black letters, 5′-3′) of Xenopus lpar6 mRNA (translational start site in red) aligned with sequence for both AMO1 (pink letters 3′-5′) and AMO2 (blue letters 3′-5′). (B) In vitro translation of Xenopus lpar6 and human LPAR6 in the presence of morpholinos. Lane 1, no MO. Lane 2, control MO. Lane 3, AMO1. Lane 4, AMO2. (C-E) Stage 28, lateral view (head to left), injected with 40 ng of morpholino. (C) Normal embryo injected with control MO (100%, n=90). (D) AMO1-injected embryo with head defect (60%, n=95). (E) AMO2-injected embryo with head defect (93%, n=75). Anteroposterior axis length of control-MO-injected embryos was 4.0 mm (s.d.=0.21, n=44) and that of AMO-injected embryos 3.4 mm (s.d.=0.17, n=44). Defects in D and E are statistically significant (Fisher’s exact test, P<0.001). (F-H) Whole-mount in situ hybridisation, with antisense foxg1 probe. Stage 24, lateral view (head to left), injected with 40 ng of morpholino. (F) Normal embryo injected with control MO (100%, n=30). (G) AMO1-injected embryo with reduced foxg1 expression (60%, n=30). (H) AMO2-injected embryo with reduced foxg1 expression (87%, n=30). Defects in G and H are statistically significant (Fisher’s exact test, P<0.001). (I-K) Stage 28, lateral view (head to left), injected with 40 ng of AMO2 and 400 pg of human LPAR6 mRNA. (I) Normal embryo injected with control MO (100%, n=30). (J) AMO2-injected embryo with head defect (80%, n=35). (K) AMO2 plus hLPAR6 mRNA-injected embryo with normal head (66%, n=35). Rescue of head development in K is statistically significant (Fisher’s exact test, P<0.001). Scale bars: 400 μm.

Fig. 4.

LPAR6 is required for forebrain development. (A) Sequence (black letters, 5′-3′) of Xenopus lpar6 mRNA (translational start site in red) aligned with sequence for both AMO1 (pink letters 3′-5′) and AMO2 (blue letters 3′-5′). (B) In vitro translation of Xenopus lpar6 and human LPAR6 in the presence of morpholinos. Lane 1, no MO. Lane 2, control MO. Lane 3, AMO1. Lane 4, AMO2. (C-E) Stage 28, lateral view (head to left), injected with 40 ng of morpholino. (C) Normal embryo injected with control MO (100%, n=90). (D) AMO1-injected embryo with head defect (60%, n=95). (E) AMO2-injected embryo with head defect (93%, n=75). Anteroposterior axis length of control-MO-injected embryos was 4.0 mm (s.d.=0.21, n=44) and that of AMO-injected embryos 3.4 mm (s.d.=0.17, n=44). Defects in D and E are statistically significant (Fisher’s exact test, P<0.001). (F-H) Whole-mount in situ hybridisation, with antisense foxg1 probe. Stage 24, lateral view (head to left), injected with 40 ng of morpholino. (F) Normal embryo injected with control MO (100%, n=30). (G) AMO1-injected embryo with reduced foxg1 expression (60%, n=30). (H) AMO2-injected embryo with reduced foxg1 expression (87%, n=30). Defects in G and H are statistically significant (Fisher’s exact test, P<0.001). (I-K) Stage 28, lateral view (head to left), injected with 40 ng of AMO2 and 400 pg of human LPAR6 mRNA. (I) Normal embryo injected with control MO (100%, n=30). (J) AMO2-injected embryo with head defect (80%, n=35). (K) AMO2 plus hLPAR6 mRNA-injected embryo with normal head (66%, n=35). Rescue of head development in K is statistically significant (Fisher’s exact test, P<0.001). Scale bars: 400 μm.

Inhibition of LPAR6 disrupts neural development

Evidence from the use of the AMO injections suggested that LPAR6 has a role in anterior neural development. We therefore injected two-cell embryos with AMO2 and used whole-mount in situ hybridisation to study neural-specific gene expression. Initially, we injected a single blastomere with 20 ng of AMO2 and observed an increase in the width of sox2 (Fig. 5A,B) and cdx4 (Fig. 5I,J) expression on the injected side of neurulae, coupled with a reduction in epidermal keratin (k81a1) expression (Fig. 5C,D). We also observed loss in expression of snai2, a neural crest marker (Fig. 5E,F), whereas myod1, a mesodermal marker, was unaffected (Fig. 5G,H). Next, we injected 20 ng of AMO2 into each blastomere at the two-cell stage and analysed gene expression in the anterior neural plate. Expression of the telencephalon marker foxg1 was greatly reduced in AMO2-injected neurulae (Fig. 5K,L), whereas the eye field markers rax and pax6 were reduced to a lesser extent (Fig. 5Q-T). The MHB marker en2 (Fig. 5O,P) and the hindbrain marker egr2 (Fig. 5M,N) were expressed at normal levels, although their expression domains appear to have shifted towards the anterior neural plate border. Telencephalon development is regulated by signals from adjacent cells, including FGF8 from the anterior neural ridge (ANR) (Wilson and Houart, 2004; Hoch et al., 2009). We therefore analysed fgf8 expression in AMO2-injected neurulae and observed that it was reduced, both in the ANR and more posteriorly at the MHB (Fig. 5U,V). There was also a reduction in diphospho-ERK (dpERK) staining in the anterior neural plate (Fig. 5W,X), demonstrating that FGF signalling was reduced in AMO2-injected embryos. Loss-of-function experiments demonstrate that LPAR6 is required for forebrain development in Xenopus embryos, perhaps by regulating FGF signalling.

Fig. 5.

LPAR6 is required for neural development. Whole-mount in situ hybridisation analysis of MO injected neurulae. (A-J) Dorsal views of neurulae injected with 20 ng of morpholino into a single blastomere at the two-cell stage. Head at the top and injected side (asterisk) on the right. (A,B) Neural plate marker sox2, with increased width on the AMO2-injected side (70%, n=40). (C,D) Epidermal marker k81a1, with decreased expression on the AMO2-injected side (75%, n=40). (E,F) Neural crest marker snai2, with reduced expression on the AMO2-injected side (69%, n=35). (G,H) Skeletal muscle marker myod1, with no defect (100%, n=38). (I,J) Posterior neural plate marker cdx4, with increased width on the AMO2-injected side (80%, n=40). (K-X) Anterodorsal views of neurulae injected with 40 ng of morpholino. (K,L) Telencephalon marker foxg1, with reduced expression in the AMO2-injected embryo (79%, n=38). (M,N) Hindbrain marker egr2, with normal expression in the AMO2-injected embryo (100%, n=35). (O,P) MHB marker en2, with normal expression in the AMO2-injected embryo (100%, n=35). Expression usually moved anteriorly (74%, n=35). (Q,R) Eyefield marker rax, with reduced expression in the AMO2-injected embryo (70%, n=40). (S,T) Eyefield marker pax6, with reduced expression in the AMO2-injected embryo (60%, n=30). (U,V) Anterior neural plate marker fgf8, with reduced expression in AMO2-injected embryos at the ANR (black arrow) and MHB (white arrow) (100%, n=23). (W,X) Whole-mount immunostaining for dpERK, with reduced ERK activity in AMO2-injected embryos at the ANR (black arrow), MHB (white arrow) and branchial arches (white arrowhead) (92%, n=36). All defects are statistically significant (Fisher’s exact test, P<0.001). Scale bars: 200 μm.

Fig. 5.

LPAR6 is required for neural development. Whole-mount in situ hybridisation analysis of MO injected neurulae. (A-J) Dorsal views of neurulae injected with 20 ng of morpholino into a single blastomere at the two-cell stage. Head at the top and injected side (asterisk) on the right. (A,B) Neural plate marker sox2, with increased width on the AMO2-injected side (70%, n=40). (C,D) Epidermal marker k81a1, with decreased expression on the AMO2-injected side (75%, n=40). (E,F) Neural crest marker snai2, with reduced expression on the AMO2-injected side (69%, n=35). (G,H) Skeletal muscle marker myod1, with no defect (100%, n=38). (I,J) Posterior neural plate marker cdx4, with increased width on the AMO2-injected side (80%, n=40). (K-X) Anterodorsal views of neurulae injected with 40 ng of morpholino. (K,L) Telencephalon marker foxg1, with reduced expression in the AMO2-injected embryo (79%, n=38). (M,N) Hindbrain marker egr2, with normal expression in the AMO2-injected embryo (100%, n=35). (O,P) MHB marker en2, with normal expression in the AMO2-injected embryo (100%, n=35). Expression usually moved anteriorly (74%, n=35). (Q,R) Eyefield marker rax, with reduced expression in the AMO2-injected embryo (70%, n=40). (S,T) Eyefield marker pax6, with reduced expression in the AMO2-injected embryo (60%, n=30). (U,V) Anterior neural plate marker fgf8, with reduced expression in AMO2-injected embryos at the ANR (black arrow) and MHB (white arrow) (100%, n=23). (W,X) Whole-mount immunostaining for dpERK, with reduced ERK activity in AMO2-injected embryos at the ANR (black arrow), MHB (white arrow) and branchial arches (white arrowhead) (92%, n=36). All defects are statistically significant (Fisher’s exact test, P<0.001). Scale bars: 200 μm.

To investigate forebrain development in more detail, we allowed AMO2-injected embryos to develop until tailbud stages (stage 26) and analysed them for telencephalon-specific gene expression (Fig. 6). In addition to foxg1, we also analysed expression of nkx2-1, a marker for the ventral telencephalon, and emx1, a marker for the dorsal telencephalon (Small et al., 2000; Bachy et al., 2002). Transcripts for foxg1 (Fig. 6A,B) and emx1 (Fig. 6E,F) were not detected in AMO2-injected embryos, and only faint signals were detected for nkx2-1 (Fig. 6C,D). Our results suggest that LPAR6 is required for the development of both dorsal and ventral regions of the Xenopus telencephalon.

Fig. 6.

LPAR6 is required for telencephalic development. Whole-mount in situ hybridisation of tailbud embryos injected with 40 ng of morpholinos; lateral views of the head. (A,B) Telencephalon marker foxg1, with loss of expression in the AMO2-injected embryo (71%, n=35). (C,D) Dorsal telencephalon marker emx1, with loss of expression in the AMO2-injected embryo (75%, n=32). (E,F) Ventral telencephalon marker nkx2-1, with reduced expression in the AMO2-injected embryo (67%, n=33). (G,H) MHB marker en2, with normal expression in the AMO2-injected embryo (100%, n=32). All defects are statistically significant (Fisher’s exact test, P<0.001). Scale bars: 200 μm.

Fig. 6.

LPAR6 is required for telencephalic development. Whole-mount in situ hybridisation of tailbud embryos injected with 40 ng of morpholinos; lateral views of the head. (A,B) Telencephalon marker foxg1, with loss of expression in the AMO2-injected embryo (71%, n=35). (C,D) Dorsal telencephalon marker emx1, with loss of expression in the AMO2-injected embryo (75%, n=32). (E,F) Ventral telencephalon marker nkx2-1, with reduced expression in the AMO2-injected embryo (67%, n=33). (G,H) MHB marker en2, with normal expression in the AMO2-injected embryo (100%, n=32). All defects are statistically significant (Fisher’s exact test, P<0.001). Scale bars: 200 μm.

LPAR6 is required in the ectoderm for telencephalon development

As lpar6 is expressed in both mesoderm and ectoderm, we wished to determine its germ layer requirement for telencephalon development and initially targeted AMO injections to pairs of blastomeres (5 ng per blastomere) at the eight-cell stage (Fig. 7A). Fate maps (Dale and Slack, 1987; Moody, 1987) have shown that the nervous system is predominantly formed by dorsal-animal blastomeres, whereas the mesoderm that underlies the forebrain is formed by dorsal-vegetal blastomeres (Fig. 7A). AMO2 disrupted tadpole morphology in all four injection sets, but forebrain defects were confined to dorsal-animal injections (Fig. 7B-F). This suggests that LPAR6 is required in the ectoderm for forebrain development. Next, we exploited the ability of dorsal mesoderm to induce foxg1 expression in animal cap ectoderm (Lupo et al., 2002). Embryos were injected at the four-cell stage, with 10 ng per blastomere of AMO2, and both the dorsal marginal zone (DMZ) and animal cap isolated from early gastrulae (stage 10). They were grafted together (Fig. 7G) and incubated until sibling embryos were late neurulae (stage 18). RT-PCR showed that foxg1 expression was reduced when an AMO2-injected animal cap was grafted with a control DMZ, but not when a control animal cap was combined with an AMO2-injected DMZ (Fig. 7H). Expression of the general neural plate marker sox2 was similar in all grafts. Our results demonstrate that LPAR6 is required in ectoderm, and not mesoderm, for telencephalon development. A requirement for LPAR6 in the ectoderm was also demonstrated in animal caps expressing Noggin, a Bone morphogenetic protein (BMP) inhibitor that induces foxg1 expression (Papalopulu and Kintner, 1996). AMO2 reduced Noggin-induced expression of foxg1 without affecting sox2 expression (supplementary material Fig. S5). As mesoderm is not induced by Noggin, the inhibitory effect of AMO2 must reside within the ectoderm.

Fig. 7.

LPAR6 is required in the ectoderm. (A) Schematic diagrams of an eight-cell Xenopus embryo, indicating injected blastomere pairs and their normal fate. (B-F) Stage 40 embryos, lateral view (head to left), injected with 5 ng per blastomere of AMO2. (B) Uninjected normal embryo (n=50). (C) DA injected embryo with head defect (86%, n=69). (D) DV injected embryo with dorsal defect but a normal head (61%, n=54). (E) VA injected embryo with tail defect but a normal head (76%, n=66). (F) VV injected embryo with defect in the posterior endoderm (arrowhead) but a normal head (60%, n=60). All defects are statistically significant (Fisher’s exact test, P<0.001). (G) Schematic diagram of animal pole (AP) and dorsal marginal zone grafts. (H) RT-PCR analysis for foxg1, sox2 and odc expression in AP:DMZ grafts. Grafts were made between uninjected (U) and AMO2-injected (M) fragments. Scale bars: 500 μm. -RT, minus reverse transcriptase control, uninjected stage 19 embryos; AP, animal pole; DA, dorsal-animal; DV, dorsal-vegetal; Ep, epidermis; He, heart; M:M, AMO2-injected AP and AMO2-injected DMZ; M:U, AMO2-injected AP and uninjected DMZ; No, notochord; NP, neural plate; U:M, uninjected AP and AMO2-injected DMZ; U:U, uninjected AP and uninjected DMZ; VA, ventral-animal; VV, ventral-vegetal; WE, stage 19 embryo.

Fig. 7.

LPAR6 is required in the ectoderm. (A) Schematic diagrams of an eight-cell Xenopus embryo, indicating injected blastomere pairs and their normal fate. (B-F) Stage 40 embryos, lateral view (head to left), injected with 5 ng per blastomere of AMO2. (B) Uninjected normal embryo (n=50). (C) DA injected embryo with head defect (86%, n=69). (D) DV injected embryo with dorsal defect but a normal head (61%, n=54). (E) VA injected embryo with tail defect but a normal head (76%, n=66). (F) VV injected embryo with defect in the posterior endoderm (arrowhead) but a normal head (60%, n=60). All defects are statistically significant (Fisher’s exact test, P<0.001). (G) Schematic diagram of animal pole (AP) and dorsal marginal zone grafts. (H) RT-PCR analysis for foxg1, sox2 and odc expression in AP:DMZ grafts. Grafts were made between uninjected (U) and AMO2-injected (M) fragments. Scale bars: 500 μm. -RT, minus reverse transcriptase control, uninjected stage 19 embryos; AP, animal pole; DA, dorsal-animal; DV, dorsal-vegetal; Ep, epidermis; He, heart; M:M, AMO2-injected AP and AMO2-injected DMZ; M:U, AMO2-injected AP and uninjected DMZ; No, notochord; NP, neural plate; U:M, uninjected AP and AMO2-injected DMZ; U:U, uninjected AP and uninjected DMZ; VA, ventral-animal; VV, ventral-vegetal; WE, stage 19 embryo.

LPAR6 and FGFs act together in head development

While looking at the control of lpar6 expression by FGF signalling, we observed enhanced head defects when embryos were co-injected with 40 ng of AMO2 and dominant-negative FGFR1 (dnfgfr1) mRNA (Fig. 8). Injection of AMO2 alone gave the expected forebrain defects (Fig. 8B), whereas dnfgfr1 mRNA (plus control MO) disrupted posterior development but had no discernible effect on head development (Fig. 8C). Remarkably, embryos co-injected with AMO2 and dnfgfr1 mRNA appeared to lack all head structures (Fig. 8D). This is a more severe phenotype than expected from the individual defects, indicating that LPA and FGF signalling might interact during the development of the anterior nervous system. We repeated this experiment using SU5402, a chemical inhibitor of FGF receptors (Mohammadi et al., 1997). Embryos injected with 40 ng of AMO2 were incubated in 10 μM SU5402, from late blastulae through early tailbud stages. This concentration of SU5402 alone gave an almost identical phenotype to injecting dnfgfr1 mRNA. We also noted that it did not affect expression of lpar6 (data not shown), which we attribute to the late application of the reagent. Embryos were analysed by RT-PCR for expression of the neural plate markers foxg1, otx2, rax, en2, egr2 and sox2, and the muscle marker myod1 (Fig. 8E). SU5402 alone had no effect on the expression of any of the neural plate markers tested but greatly reduced expression of myod1, a gene known to be regulated by FGF signalling (Standley et al., 2001; Fisher et al., 2002). AMO2 alone only reduced expression of foxg1 and otx2, the most anteriorly expressed genes tested. By contrast, AMO2-injected embryos treated with SU5402 displayed reduced expression of all five anterior neural plate markers (foxg1, otx2, rax, en2 and egr2), but not the general neural plate marker sox2. Our results indicate that signalling pathways activated by LPAR6 and FGF interact in a redundant fashion to pattern the anterior nervous system.

Fig. 8.

LPAR6 and FGF co-regulate neural development. (A-D) stage 32, lateral view (head to left), injected with 40 ng per blastomere of MO plus or minus 1 ng of dominant-negative FGFR1 (dnfgfr1) mRNA. (A) Normal embryo injected with control MO (100%, n=27). (B) AMO2-injected embryo with head defect (81%, n=37). (C) Control MO plus dnfgfr1-injected embryo with posterior defect but normal head (92%, n=25). (D) AMO2 plus dnfgfr1-injected embryo with both head and posterior defects (100%, n=28). Note that the head defect is more severe than with AMO alone. All defects are statistically significant (Fisher’s exact test, P<0.001). (E) RT-PCR analysis of MO-injected embryos incubated with or without 10 μM SU5402, from stage 9 to stage 16. Embryos were analysed for expression of the foxg1 and otx2 (forebrain), rax (eyefield), en2 (MHB), egr2 (hindbrain), sox2 (neural plate), myod1 (skeletal muscle) and odc (control). Scale bars: 500 μm. -RT, control-morpholino-injected embryos.

Fig. 8.

LPAR6 and FGF co-regulate neural development. (A-D) stage 32, lateral view (head to left), injected with 40 ng per blastomere of MO plus or minus 1 ng of dominant-negative FGFR1 (dnfgfr1) mRNA. (A) Normal embryo injected with control MO (100%, n=27). (B) AMO2-injected embryo with head defect (81%, n=37). (C) Control MO plus dnfgfr1-injected embryo with posterior defect but normal head (92%, n=25). (D) AMO2 plus dnfgfr1-injected embryo with both head and posterior defects (100%, n=28). Note that the head defect is more severe than with AMO alone. All defects are statistically significant (Fisher’s exact test, P<0.001). (E) RT-PCR analysis of MO-injected embryos incubated with or without 10 μM SU5402, from stage 9 to stage 16. Embryos were analysed for expression of the foxg1 and otx2 (forebrain), rax (eyefield), en2 (MHB), egr2 (hindbrain), sox2 (neural plate), myod1 (skeletal muscle) and odc (control). Scale bars: 500 μm. -RT, control-morpholino-injected embryos.

Inhibition of ENPP2 disrupts forebrain development

To further test the role of LPA in forebrain development we turned to loss-of-function experiments for ENPP2, a secreted phospholipase that synthesises extracellular LPA (Tokumura et al., 2002; Umezu-Goto et al., 2002). Xenopus enpp2 is expressed throughout development and transcripts are enriched in the nervous system of neurulae (Massé et al., 2010b). An AMO targeting the translational start site of both enpp2a and enpp2b was designed (Fig. 9A) and injected into Xenopus embryos with enpp2a mRNA. Western blot analysis showed that this AMO efficiently inhibited translation of co-injected mRNA (Fig. 9B). Next, we injected 10 ng of enpp2 AMO into each blastomere at the two-cell stage and the first defects were detected at the end of neurulation, when AMO-injected embryos were found to be shorter than controls (Fig. 9C,D). The average anteroposterior axis length of AMO-injected embryos was only 72% of that of control embryos (2.9 mm compared to 4.0 mm, t-test, P<0.005). It was also clear that the anterior neural plate had failed to close in most AMO-injected embryos (74%, n=105), consistent with loss-of-function studies in mice (van Meeteren et al., 2006; Fotopoulou et al., 2010; Koike et al., 2011). To determine whether ENPP2 is required for forebrain development, we used whole-mount in situ hybridisation to analyse expression of anterior neural plate markers. Expression of the telencephalic markers foxg1 (Fig. 9E,F), nkx2-1 (Fig. 9G,H) and emx1 (Fig. 9I,J) were greatly reduced in AMO-injected neurulae, whereas expression of the eyefield marker rax (Fig. 9K,L) was unaffected. Expression of the midbrain-hindbrain marker en2 was normal in most embryos but reduced in a small number (Fig. 9M,N). We also observed a reduction in expression of fgf8 in the ANR and MHB (Fig. 9O,P), as well as a reduction in dpERK staining in the anterior neural plate (Fig. 9Q,R). Our results demonstrate a role for ENPP2 in anterior neural plate development. These defects are similar to those caused by LPAR6 loss of function (above), confirming a role for LPA signalling in forebrain development.

Fig. 9.

ENPP2 is required for forebrain development. (A) Sequence of Xenopus enpp2a (black lettering, 5′-3′) and enpp2b (green lettering, 5-3′), translational start site in red, aligned with sequence for AMO (blue letters, 3′-5′). (B) Western blot analysis of Xenopus embryos injected with 1 μg of enpp2a.myc mRNA and 40 ng of morpholino. (C,D) Stage 28, lateral views (head to right) injected with 20 ng of either control MO or enpp2-AMO. Anteroposterior axis length of control-morpholino-injected embryos was 4.0 mm (s.d.=0.13, n=45) and that of AMO-injected embryos 2.9 mm (s.d.=0.22, n=45). (E-P) Whole-mount in situ hybridisation analysis of neurulae injected with 20 ng of either control (CMO) or enpp2-AMO. All embryos are viewed from anterodorsal perspective. (E,F) Telencephalon marker foxg1, with reduced expression in AMO-injected embryo (57%, n=82) (G,H) Ventral telencephalon marker nkx2-1, with reduced expression in AMO-injected embryo (59%, n=70). (I,J) Dorsal telencephalon marker emx1, with reduced expression in AMO-injected embryo (72%, n=53). (K,L) Eyefield marker rax, with normal expression in AMO-injected embryo (100%, n=77). (M,N) MHB marker en2, with reduced expression in AMO-injected embryo (16%, n=73 - 6% in controls, n=50). (O,P) Anterior neural plate marker fgf8, with reduced expression in AMO-injected embryo in both ANR (black arrow) and MHB (white arrow) (71%, n=21). (Q,R) Whole-mount immunolocalisation for dpERK. Note reduced ERK activity in AMO-injected embryos in the ANR (black arrow), the MHB (white arrow) and the branchial arches (white arrowhead) (96%, n=26). All defects are statistically significant (Fisher’s exact test, P<0.001) except for en2 (M,N). Scale bars: 600 μm in C,D; 200 μm in E-P.

Fig. 9.

ENPP2 is required for forebrain development. (A) Sequence of Xenopus enpp2a (black lettering, 5′-3′) and enpp2b (green lettering, 5-3′), translational start site in red, aligned with sequence for AMO (blue letters, 3′-5′). (B) Western blot analysis of Xenopus embryos injected with 1 μg of enpp2a.myc mRNA and 40 ng of morpholino. (C,D) Stage 28, lateral views (head to right) injected with 20 ng of either control MO or enpp2-AMO. Anteroposterior axis length of control-morpholino-injected embryos was 4.0 mm (s.d.=0.13, n=45) and that of AMO-injected embryos 2.9 mm (s.d.=0.22, n=45). (E-P) Whole-mount in situ hybridisation analysis of neurulae injected with 20 ng of either control (CMO) or enpp2-AMO. All embryos are viewed from anterodorsal perspective. (E,F) Telencephalon marker foxg1, with reduced expression in AMO-injected embryo (57%, n=82) (G,H) Ventral telencephalon marker nkx2-1, with reduced expression in AMO-injected embryo (59%, n=70). (I,J) Dorsal telencephalon marker emx1, with reduced expression in AMO-injected embryo (72%, n=53). (K,L) Eyefield marker rax, with normal expression in AMO-injected embryo (100%, n=77). (M,N) MHB marker en2, with reduced expression in AMO-injected embryo (16%, n=73 - 6% in controls, n=50). (O,P) Anterior neural plate marker fgf8, with reduced expression in AMO-injected embryo in both ANR (black arrow) and MHB (white arrow) (71%, n=21). (Q,R) Whole-mount immunolocalisation for dpERK. Note reduced ERK activity in AMO-injected embryos in the ANR (black arrow), the MHB (white arrow) and the branchial arches (white arrowhead) (96%, n=26). All defects are statistically significant (Fisher’s exact test, P<0.001) except for en2 (M,N). Scale bars: 600 μm in C,D; 200 μm in E-P.

Xenopus LPAR6

In this study we describe Xenopus LPAR6, a GPCR for the bioactive lipid LPA (Choi et al., 2010; Chun et al., 2010). We have shown that it is transcribed from late blastulae and enriched in the mesoderm of early gastrulae, with transcription regulated by FGF signalling. The distribution of lapr6 transcripts in early gastrulae is very similar to that of fgf4 and fgf8 (Isaacs et al., 1995; Christen and Slack, 1997; Lea et al., 2009), and to FGF-dependent Extracellular-signal-related kinase (ERK) activity (Christen and Slack, 1999). Transcription is rapidly induced (30 minutes to 1 hour) by FGF4 in blastula stage animal caps and inhibited in early gastrulae by dominant-negative FGF receptors. We also find that lpar6 is one of the first FGF responsive genes to be transcribed in late blastulae, suggesting that it is transcribed as an immediate-early response to FGF signalling. Inhibition of FGF signalling causes specific defects in posterior mesoderm formation (Amaya et al., 1991; Isaacs et al., 1998) and similar defects have been observed following inhibition of a number of FGF target genes, including bra and cdx4 (Conlon et al., 1996; Isaacs et al., 1998). Surprisingly, we were unable to detect any effect of inhibiting LPAR6 function on mesoderm formation. Either LPAR6 is not an effector of FGF signalling in these processes, or different LPA receptor subtypes can compensate for defective LPAR6 signalling. Transcripts for lpar1, lpar2, lpar4 and lpar5 have been detected in Xenopus embryos (Lloyd et al., 2005; Massé et al., 2010a). As different LPA receptor subtypes have been shown to activate similar intracellular signalling pathways within a single cell (Dubin et al., 2010), it is possible that one or more of these Xenopus receptors could compensate for defective LPAR6 function at this stage.

LPA is required for anterior neural development

Xenopus lpar6 is expressed in the neural ectoderm of both early gastrulae and neurulae, and it is in the ectoderm of neurulae that we observed the first defects in loss-of-function experiments. We found that the width of the neural plate was increased throughout its length, as demonstrated by sox2 and cdx4 expression. This may be caused by defects in convergent-extension, coordinated cell intercalation that both narrows and extends the neural plate (Elul and Keller, 2000). Further studies will be required to confirm this, but we observed a reduced anteroposterior axis length in lpar6-AMO-injected embryos, expected of embryos with defective convergent-extension. However, we note that the neural tube of lpar6-AMO-injected embryos is fully closed, whereas neural tube defects are common in embryos with disrupted convergent-extension movements (Wallingford and Harland, 2002). A reduction in the size of the forebrain was also observed in lpar6-AMO-injected embryos, as demonstrated by reduced expression of the telencephalic marker foxg1. Both dorsal (emx1 expression) and ventral (nkx2-1 expression) regions of the telencephalon were affected. We also observed reduced fgf8 expression and ERK activity (in the ANR and MHB), as well as reduced rax and pax6 expression (in the eyefield). More posterior regions of the brain (en2 and egr2 expression) were not affected. Reduced foxg1 expression was dependent upon inhibiting LPAR6 within the ectoderm, indicating that the role of LPAR6 is intrinsic to the developing forebrain. Our results suggest that LPA signalling through LPAR6 is required in the anterior neural ectoderm for telencephalic development.

We observed similar defects in embryos injected with an AMO for ENPP2, a secreted enzyme that synthesises extracellular LPA (Tokumura et al., 2002; Umezu-Goto et al., 2002). Enpp2 is expressed throughout Xenopus development and enriched in the neural plate of neurulae, then the anterior nervous system and neural crest following the completion of neurulation (Massé et al., 2010b). The most obvious defect that we observed following AMO injection was truncation of the anteroposterior axis, which was often accompanied by defects in anterior neural tube closure. Both defects are consistent with a role for ENPP2 in regulating convergent-extension in the neural plate. Further studies will be required to confirm this. We also observed reduced expression of the telencephalic markers foxg1, emx1 and nkx2-1 in neurulae, indicating that both dorsal and ventral regions of the telencephalon were affected. Both fgf8 expression and ERK activity was reduced in the anterior neural plate of AMO-injected embryos. In contrast to lpar6-AMO-injected embryos, we did not observe reduced expression of the eyefield marker rax. Our results are consistent with studies on mice homozygous for mutations in Enpp2. E8.5 homozygous mutant embryos display defects in the anterior nervous system, both neural tube defects and reduced expression of anterior neural markers (van Meeteren et al., 2006; Fotopoulou et al., 2010). Reduced expression was described for Otx2, Six3, Tcf4 and Fgf8, indicating defects in forebrain development (Koike et al., 2011). In contrast to our results in Xenopus, expression of the ventral telencephalic marker Nkx2-1 was not reduced in Enpp2-/- mice (Koike et al., 2011). However, we note that reduced expression of nkx2-1 (but not foxg1 or emx1) in enpp2-AMO-injected Xenopus embryos was only transient, with expression restored by early tailbud stages (supplementary material Fig. S6). The similarities between the results of loss-of-function studies in Xenopus and the mouse suggest a key role for LPA in regulating telencephalon development. Moreover, they suggest that Xenopus is an ideal organism for studying these defects. Xenopus embryos are accessible at all stages of development and can survive with the vascular defects that kill Enpp2-/- mouse embryos by embryonic day (E) 9.5-10.5 (van Meeteren et al., 2006; Fotopoulou et al., 2010).

Functional cooperation between LPAR6 and FGF signalling

The telencephalon is the most anterior region of the vertebrate forebrain and will eventually form the cerebrum, including cerebral hemispheres, olfactory system and basal ganglia. Its development is regulated by numerous signals from organising centres in adjacent regions of the embryo, including the ANR (Hébert and Fishell, 2008; Hoch et al., 2009). This region is a source for a number of FGF signals, including FGF8, and FGF will induce ectopic foxg1 expression in the anterior neural plate (Shimamura and Rubenstein, 1997; Eagleson and Dempewolf, 2002). Furthermore, fgf8 mutant zebrafish and mouse embryos display telencephalic defects (Meyers et al., 1998; Shanmugalingam et al., 2000; Walshe and Mason, 2003). In addition, progressively more severe telencephalic defects have been described in mouse embryos with single, double and triple mutations for Fgfr1, Fgfr2 and Fgfr3 (Paek et al., 2009). These results highlight the importance of FGF signalling for telencephalon development. We note that AMO for both lpar6 and enpp2 reduce fgf8 expression in the ANR of Xenopus neurulae and dpERK in the anterior neural plate, demonstrating reduced FGF signalling in the presumptive telencephalon. This suggests an explanation for our results in which LPA signalling is required for fgf8 expression in the ANR, with reduced expression of fgf8 being responsible for defects in telencephalic development. However, fgf8-AMO injection experiments in Xenopus have failed to detect a role for FGF8 in forebrain development (Fletcher et al., 2006). This might reflect redundant functions among different FGFs, as both fgf3 and fgf8 are required for telencephalon development in zebrafish (Walshe and Mason, 2003).

A link between LPAR6 and FGF signalling in anterior neural development was also demonstrated in experiments in which we inhibited both pathways. dnFGFR1 disrupts the development of the trunk and tail of Xenopus embryos but has very little effect on the head (Amaya et al., 1991; Isaacs et al., 1998). Yet, when combined with inhibition of LPAR6 we observed a dramatic reduction in head development, far greater than the forebrain defects observed by inhibiting LPAR6 alone. We observed the same effect when FGF signalling was inhibited by SU5402, a small molecule inhibitor of FGF receptors (Mohammadi et al., 1997). Phenotypic enhancement, as observed here, is usually an indicator of genetic interaction and probably reflects a degree of functional redundancy. We suggest that LPAR6 and FGF signalling are required throughout the developing brain but only the telencephalon is sensitive to reductions in signalling by LPAR6 alone. Only by inhibiting both pathways is a broader role in brain development revealed. Further studies are required to determine the level at which these signalling pathways interact, but ERK1/2 is a potential candidate. ERK1/2 is a key component of the canonical FGF signalling pathway (Dorey and Amaya, 2010; Pownall and Isaacs, 2010) and also a target of LPAR6 signalling (Lee et al., 2009). Although activation of ERK1/2 in early Xenopus embryos is predominantly FGF dependent (LaBonne and Whitman, 1997; Christen and Slack, 1999) a degree of LPAR6 dependency cannot be excluded. How LPA signalling regulates ERK activity in Xenopus embryos needs to be explored but it might involve the G protein Gαi, as LPA-induced ERK activation in hBRIE 308i cells was blocked by the Gαi inhibitor pertussis toxin (Lee et al., 2009). An alternative mechanism is suggested by a study on hair follicle development in mice, which showed that LPAR6 acts through Gα13 to stimulate TNFα converting enzyme (TACE)-mediated ectodomain shedding of TGFα (Inoue et al., 2011). TGFα stimulates ERK activity via the Epidermal growth factor (EGF) receptor. It is of interest that AMO for the EGF-like receptor ERBB4 generates posterior defects similar to those caused by dnFGFR1, defects rescued by increasing ERK activity (Nie and Chang, 2007).

Conclusions

Our results show that LPA signalling, acting through the LPAR6 receptor, is required in the initial specification and/or maintenance of the telencephalon, the most anterior region of the vertebrate brain. This is only the second LPAR receptor, after LPAR1 (Estivill-Torrús et al., 2008), that has been shown to have a role in early neural development, even though multiple receptor subtypes are expressed in the developing nervous system (Ohuchi et al., 2008; Massé et al., 2010a). The cellular and molecular basis of this role will require further studies, as will identifying the source of the LPA signals. Previous studies have shown that LPAR6 is required for hair growth in humans, but no evidence for a role in brain function was obtained. Either LPAR6 has evolved different roles in amphibians and mammals, or functional redundancy among the different LPA receptor subtypes masks the role of LPAR6 in mammalian forebrain development.

Embryo methods

Xenopus laevis embryos were injected at either the two, four or eight-cell stage and incubated at 14-18°C. Animal caps were isolated at stage 8 and cultured in 50% Normal Amphibian Medium containing either 10 u/ml of Xenopus FGF4 (Isaacs et al., 1992) or 10 u/ml human Activin A (Sigma). Stage 10.5 DMZ and animal cap explants were grafted together and cultured until stage 18. Embryos were incubated in 10 μM SU5402 (Calbiochem) from stage 9 to stage 16. Whole-mount in situ hybridisation was performed using digoxigenin-labelled antisense probes (Sive et al., 2000). Immunostaining was performed using anti-diphospho-ERK (Sigma) (Christen and Slack, 1999). Animal procedures were performed under license, as required by the Animals (Scientific Procedures) Act 1986 (UK).

Sequences and AMO

EST for Xenopus laevis lpar6 (IMAGE:3420557; Accession number BG552112) and enpp2 (IMAGE:5570505; Accession number BQ736035) were purchased from Geneservice (Cambridge, UK) and sequenced. The Accession number for lpar6 is HF558446, and enpp2 is identical to NM_001087057. Lpar6 was inserted into pCS2+ and enpp2 into pCS2+myc. AMO for lpar6 (AMO1, 5′-TACCATTGCTTGTTATCGTGTCTAA-3′; AMO2, 5′-TTCCTTGAGCGTTACTACCATTGC-3′), ennp2 (5′-CTGAATCCGTTTTTCATTGCCATAG-3′), and standard control (5′-CTGAATCCGTTTTTCATTGCCATAG-3′) were purchased from Gene Tools. Lpar6 AMO were tested by adding 1 μg to an SP6 TNT coupled reticulocyte lysate cell free translation system (Promega), loaded with 1 μg of lpar6 cDNA and 35S-methionine (GE Healthcare). Products were separated on NuPAGE 4-12% bis-Tris gels (Invitrogen) and exposed to autoradiographic film (GE Healthcare). Enpp2 AMO was tested by co-injecting Xenopus embryos with 40 ng of AMO and 1 μg of enpp2.myc mRNA. Proteins were isolated at stage 9 and ENPP2 detected by western blot using 9E10 monoclonal antibody (Santa Cruz Biotechnology) (Geach and Dale, 2008). Capped mRNA for human LPAR6 (Janssens et al., 1997), ENPP2.myc, dnFGFR1 (Amaya et al., 1991) and dnFGFR4 (Hongo et al., 1999) were transcribed using the SP6 mMessage mMachine kit (Ambion).

RT-PCR

Total RNA was purified using RNeasy columns (Qiagen) and cDNA synthesised using ImProm II reverse transcriptase and random primers (Promega). PCR was performed with Taq polymerase (New England Biolabs), using 0.5 μl of cDNA in a final volume of 25 μl for 26-28 cycles. Primers (5′-3′) used were: egr2 (CCGGCCCATCCTCAGACCCAGAAA and CGCCACGCCGCTGTTGCCGAGTTC), en2 (ATGAGCAGAATAACAGGGAAGTGGA and CCTCGGGGACATTGACTCGGTGGTG), foxg1 (AAAGTGGACGGCAAAGACGGTG and CCAATGAACACATCGT CGCTGC), lpar6 (AGCATCTATCACCAGCAGCAGG and TGCCGCAACCTTACTGAGACAG), myod1 (AGGTCCAACTGCTCCGACGGCA TGAA and AGGAGAGAATCCAGTTGATGGAAACA), odc (CAGCTAGCTGTGGTGTGG and CAACATGGAAACTCACACC), otx2 (GGATGGATTTGTTGCACCAGTC and CACTCTCCGAGCTCACT TCTC), rax (AGACTGGTGGCTATGGAG and ATACCTGCACCCTG ACTT), sox2 (GAGGATGGACACTTATGCCCAC and GGACATGCTGTAGGTAGGCGA).

Microarray assays

Microarray data were derived from published data sets (Branney et al., 2009). Affymetrix Cel files are available at EMBL ArrayExpress, accession numbers E-MEXP-2058 and E-MEXP-2059.

We thank Carlos Carmona-Fontaine, Philippa Francis-West, Sandip Patel, Ben Steventon, Andrea Townsend-Nicholson, Anne Warner and Steve Wilson for advice or helpful comments on the manuscript.

Author contributions

The project was designed by T.J.G., C.D., H.V.I. and L.D. Experiments were performed in the laboratories of L.D. and H.V.I. All authors contributed to the figures presented and interpreted the results. L.D., H.V.I. and T.J.G. wrote the manuscript, with remaining authors commenting on the manuscript.

Funding

The work was supported by project grants from the Biotechnology and Biological Sciences Research Council [BBS/B/0661X to L.D. and BB/D010039/1 to H.V.I.].

Amaya
E.
,
Musci
T. J.
,
Kirschner
M. W.
(
1991
).
Expression of a dominant negative mutant of the FGF receptor disrupts mesoderm formation in Xenopus embryos
.
Cell
66
,
257
270
.
Bachy
I.
,
Berthon
J.
,
Rétaux
S.
(
2002
).
Defining pallial and subpallial divisions in the developing Xenopus forebrain
.
Mech. Dev.
117
,
163
172
.
Branney
P. A.
,
Faas
L.
,
Steane
S. E.
,
Pownall
M. E.
,
Isaacs
H. V.
(
2009
).
Characterisation of the fibroblast growth factor dependent transcriptome in early development
.
PLoS ONE
4
,
e4951
.
Choi
J. W.
,
Herr
D. R.
,
Noguchi
K.
,
Yung
Y. C.
,
Lee
C. W.
,
Mutoh
T.
,
Lin
M. E.
,
Teo
S. T.
,
Park
K. E.
,
Mosley
A. N.
, et al. 
. (
2010
).
LPA receptors: subtypes and biological actions
.
Annu. Rev. Pharmacol. Toxicol.
50
,
157
186
.
Christen
B.
,
Slack
J. M.
(
1997
).
FGF-8 is associated with anteroposterior patterning and limb regeneration in Xenopus
.
Dev. Biol.
192
,
455
466
.
Christen
B.
,
Slack
J. M.
(
1999
).
Spatial response to fibroblast growth factor signalling in Xenopus embryos
.
Development
126
,
119
125
.
Chun
J.
,
Hla
T.
,
Lynch
K. R.
,
Spiegel
S.
,
Moolenaar
W. H.
(
2010
).
International Union of Basic and Clinical Pharmacology. LXXVIII. Lysophospholipid receptor nomenclature
.
Pharmacol. Rev.
62
,
579
587
.
Conlon
F. L.
,
Sedgwick
S. G.
,
Weston
K. M.
,
Smith
J. C.
(
1996
).
Inhibition of Xbra transcription activation causes defects in mesodermal patterning and reveals autoregulation of Xbra in dorsal mesoderm
.
Development
122
,
2427
2435
.
Contos
J. J.
,
Fukushima
N.
,
Weiner
J. A.
,
Kaushal
D.
,
Chun
J.
(
2000
).
Requirement for the lpA1 lysophosphatidic acid receptor gene in normal suckling behavior
.
Proc. Natl. Acad. Sci. USA
97
,
13384
13389
.
Contos
J. J.
,
Ishii
I.
,
Fukushima
N.
,
Kingsbury
M. A.
,
Ye
X.
,
Kawamura
S.
,
Brown
J. H.
,
Chun
J.
(
2002
).
Characterization of lpa(2) (Edg4) and lpa(1)/lpa(2) (Edg2/Edg4) lysophosphatidic acid receptor knockout mice: signaling deficits without obvious phenotypic abnormality attributable to lpa(2)
.
Mol. Cell. Biol.
22
,
6921
6929
.
Dale
L.
,
Slack
J. M.
(
1987
).
Fate map for the 32-cell stage of Xenopus laevis
.
Development
99
,
527
551
.
Dorey
K.
,
Amaya
E.
(
2010
).
FGF signalling: diverse roles during early vertebrate embryogenesis
.
Development
137
,
3731
3742
.
Dubin
A. E.
,
Herr
D. R.
,
Chun
J.
(
2010
).
Diversity of lysophosphatidic acid receptor-mediated intracellular calcium signaling in early cortical neurogenesis
.
J. Neurosci.
30
,
7300
7309
.
Eagleson
G. W.
,
Dempewolf
R. D.
(
2002
).
The role of the anterior neural ridge and Fgf-8 in early forebrain patterning and regionalization in Xenopus laevis
.
Comp. Biochem. Physiol.
132B
,
179
189
.
Elul
T.
,
Keller
R.
(
2000
).
Monopolar protrusive activity: a new morphogenic cell behavior in the neural plate dependent on vertical interactions with the mesoderm in Xenopus
.
Dev. Biol.
224
,
3
19
.
Estivill-Torrús
G.
,
Llebrez-Zayas
P.
,
Matas-Rico
E.
,
Santín
L.
,
Pedraza
C.
,
De Diego
I.
,
Del Arco
I.
,
Fernández-Llebrez
P.
,
Chun
J.
,
De Fonseca
F. R.
(
2008
).
Absence of LPA1 signaling results in defective cortical development
.
Cereb. Cortex
18
,
938
950
.
Fisher
M. E.
,
Isaacs
H. V.
,
Pownall
M. E.
(
2002
).
eFGF is required for activation of XmyoD expression in the myogenic cell lineage of Xenopus laevis
.
Development
129
,
1307
1315
.
Fletcher
R. B.
,
Baker
J. C.
,
Harland
R. M.
(
2006
).
FGF8 spliceforms mediate early mesoderm and posterior neural tissue formation in Xenopus
.
Development
133
,
1703
1714
.
Fotopoulou
S.
,
Oikonomou
N.
,
Grigorieva
E.
,
Nikitopoulou
I.
,
Paparountas
T.
,
Thanassopoulou
A.
,
Zhao
Z.
,
Xu
Y.
,
Kontoyiannis
D. L.
,
Remboutsika
E.
, et al. 
. (
2010
).
ATX expression and LPA signalling are vital for the development of the nervous system
.
Dev. Biol.
339
,
451
464
.
Geach
T. J.
,
Dale
L.
(
2008
).
Molecular determinants of Xolloid action in vivo
.
J. Biol. Chem.
283
,
27057
27063
.
Hébert
J. M.
,
Fishell
G.
(
2008
).
The genetics of early telencephalon patterning: some assembly required
.
Nat. Rev. Neurosci.
9
,
678
685
.
Hecht
J. H.
,
Weiner
J. A.
,
Post
S. R.
,
Chun
J.
(
1996
).
Ventricular zone gene-1 (vzg-1) encodes a lysophosphatidic acid receptor expressed in neurogenic regions of the developing cerebral cortex
.
J. Cell Biol.
135
,
1071
1083
.
Herzog
H.
,
Darby
K.
,
Hort
Y. J.
,
Shine
J.
(
1996
).
Intron 17 of the human retinoblastoma susceptibility gene encodes an actively transcribed G protein-coupled receptor gene
.
Genome Res.
6
,
858
861
.
Hoch
R. V.
,
Rubenstein
J. L.
,
Pleasure
S.
(
2009
).
Genes and signaling events that establish regional patterning of the mammalian forebrain
.
Semin. Cell Dev. Biol.
20
,
378
386
.
Hongo
I.
,
Kengaku
M.
,
Okamoto
H.
(
1999
).
FGF signaling and the anterior neural induction in Xenopus
.
Dev. Biol.
216
,
561
581
.
Inoue
A.
,
Arima
N.
,
Ishiguro
J.
,
Prestwich
G. D.
,
Arai
H.
,
Aoki
J.
(
2011
).
LPA-producing enzyme PA-PLA1α regulates hair follicle development by modulating EGFR signalling
.
EMBO J.
30
,
4248
4260
.
Isaacs
H. V.
,
Tannahill
D.
,
Slack
J. M.
(
1992
).
Expression of a novel FGF in the Xenopus embryo. A new candidate inducing factor for mesoderm formation and anteroposterior specification
.
Development
114
,
711
720
.
Isaacs
H. V.
,
Pownall
M. E.
,
Slack
J. M.
(
1995
).
eFGF is expressed in the dorsal midline of Xenopus laevis
.
Int. J. Dev. Biol.
39
,
575
579
.
Isaacs
H. V.
,
Pownall
M. E.
,
Slack
J. M.
(
1998
).
Regulation of Hox gene expression and posterior development by the Xenopus caudal homologue Xcad3
.
EMBO J.
17
,
3413
3427
.
Janssens
R.
,
Boeynaems
J. M.
,
Godart
M.
,
Communi
D.
(
1997
).
Cloning of a human heptahelical receptor closely related to the P2Y5 receptor
.
Biochem. Biophys. Res. Commun.
236
,
106
112
.
Kaplan
M. H.
,
Smith
D. I.
,
Sundick
R. S.
(
1993
).
Identification of a G protein coupled receptor induced in activated T cells
.
J. Immunol.
151
,
628
636
.
Kazantseva
A.
,
Goltsov
A.
,
Zinchenko
R.
,
Grigorenko
A. P.
,
Abrukova
A. V.
,
Moliaka
Y. K.
,
Kirillov
A. G.
,
Guo
Z.
,
Lyle
S.
,
Ginter
E. K.
, et al. 
. (
2006
).
Human hair growth deficiency is linked to a genetic defect in the phospholipase gene LIPH
.
Science
314
,
982
985
.
Koike
S.
,
Keino-Masu
K.
,
Masu
M.
(
2010
).
Deficiency of autotaxin/lysophospholipase D results in head cavity formation in mouse embryos through the LPA receptor-Rho-ROCK pathway
.
Biochem. Biophys. Res. Commun.
400
,
66
71
.
Koike
S.
,
Yutoh
Y.
,
Keino-Masu
K.
,
Noji
S.
,
Masu
M.
,
Ohuchi
H.
(
2011
).
Autotaxin is required for the cranial neural tube closure and establishment of the midbrain-hindbrain boundary during mouse development
.
Dev. Dyn.
240
,
413
421
.
LaBonne
C.
,
Whitman
M.
(
1997
).
Localization of MAP kinase activity in early Xenopus embryos: implications for endogenous FGF signaling
.
Dev. Biol.
183
,
9
20
.
Lea
R.
,
Papalopulu
N.
,
Amaya
E.
,
Dorey
K.
(
2009
).
Temporal and spatial expression of FGF ligands and receptors during Xenopus development
.
Dev. Dyn.
238
,
1467
1479
.
Lee
Z.
,
Cheng
C. T.
,
Zhang
H.
,
Subler
M. A.
,
Wu
J.
,
Mukherjee
A.
,
Windle
J. J.
,
Chen
C. K.
,
Fang
X.
(
2008
).
Role of LPA4/p2y9/GPR23 in negative regulation of cell motility
.
Mol. Biol. Cell
19
,
5435
5445
.
Lee
M.
,
Choi
S.
,
Halldén
G.
,
Yo
S. J.
,
Schichnes
D.
,
Aponte
G. W.
(
2009
).
P2Y5 is a G(alpha)i, G(alpha)12/13 G protein-coupled receptor activated by lysophosphatidic acid that reduces intestinal cell adhesion
.
Am. J. Physiol.
297
,
G641
G654
.
Li
Q.
,
Schachter
J. B.
,
Harden
T. K.
,
Nicholas
R. A.
(
1997
).
The 6H1 orphan receptor, claimed to be the p2y5 receptor, does not mediate nucleotide-promoted second messenger responses
.
Biochem. Biophys. Res. Commun.
236
,
455
460
.
Lin
M. E.
,
Rivera
R. R.
,
Chun
J.
(
2012
).
Targeted deletion of LPA5 identifies novel roles for lysophosphatidic acid signaling in development of neuropathic pain
.
J. Biol. Chem.
287
,
17608
17617
.
Lloyd
B.
,
Tao
Q.
,
Lang
S.
,
Wylie
C.
(
2005
).
Lysophosphatidic acid signaling controls cortical actin assembly and cytoarchitecture in Xenopus embryos
.
Development
132
,
805
816
.
Lupo
G.
,
Harris
W. A.
,
Barsacchi
G.
,
Vignali
R.
(
2002
).
Induction and patterning of the telencephalon in Xenopus laevis
.
Development
129
,
5421
5436
.
Massé
K.
,
Kyuno
J.
,
Bhamra
S.
,
Jones
E. A.
(
2010a
).
The lysophosphatidic acid (LPA) and sphingosine-1-phosphate (S1P) receptor gene families: cloning and comparative expression analysis in Xenopus laevis
.
Int. J. Dev. Biol.
54
,
1361
1374
.
Massé
K.
,
Bhamra
S.
,
Allsop
G.
,
Dale
N.
,
Jones
E. A.
(
2010b
).
Ectophosphodiesterase/nucleotide phosphohydrolase (Enpp) nucleotidases: cloning, conservation and developmental restriction
.
Int. J. Dev. Biol.
54
,
181
193
.
Meyers
E. N.
,
Lewandoski
M.
,
Martin
G. R.
(
1998
).
An Fgf8 mutant allelic series generated by Cre- and Flp-mediated recombination
.
Nat. Genet.
18
,
136
141
.
Mohammadi
M.
,
McMahon
G.
,
Sun
L.
,
Tang
C.
,
Hirth
P.
,
Yeh
B. K.
,
Hubbard
S. R.
,
Schlessinger
J.
(
1997
).
Structures of the tyrosine kinase domain of fibroblast growth factor receptor in complex with inhibitors
.
Science
276
,
955
960
.
Moody
S. A.
(
1987
).
Fates of the blastomeres of the 32-cell-stage Xenopus embryo
.
Dev. Biol.
122
,
300
319
.
Nie
S.
,
Chang
C.
(
2007
).
PI3K and Erk MAPK mediate ErbB signaling in Xenopus gastrulation
.
Mech. Dev.
124
,
657
667
.
Noguchi
K.
,
Herr
D.
,
Mutoh
T.
,
Chun
J.
(
2009
).
Lysophosphatidic acid (LPA) and its receptors
.
Curr. Opin. Pharmacol.
9
,
15
23
.
Ohuchi
H.
,
Hamada
A.
,
Matsuda
H.
,
Takagi
A.
,
Tanaka
M.
,
Aoki
J.
,
Arai
H.
,
Noji
S.
(
2008
).
Expression patterns of the lysophospholipid receptor genes during mouse early development
.
Dev. Dyn.
237
,
3280
3294
.
Paek
H.
,
Gutin
G.
,
Hébert
J. M.
(
2009
).
FGF signaling is strictly required to maintain early telencephalic precursor cell survival
.
Development
136
,
2457
2465
.
Papalopulu
N.
,
Kintner
C.
(
1996
).
A Xenopus gene, Xbr-1, defines a novel class of homeobox genes and is expressed in the dorsal ciliary margin of the eye
.
Dev. Biol.
174
,
104
114
.
Pasternack
S. M.
,
von Kügelgen
I.
,
Al Aboud
K.
,
Lee
Y. A.
,
Rüschendorf
F.
,
Voss
K.
,
Hillmer
A. M.
,
Molderings
G. J.
,
Franz
T.
,
Ramirez
A.
, et al. 
. (
2008
).
G protein-coupled receptor P2Y5 and its ligand LPA are involved in maintenance of human hair growth
.
Nat. Genet.
40
,
329
334
.
Pasternack
S. M.
,
Murugusundram
S.
,
Eigelshoven
S.
,
Müller
M.
,
Kruse
R.
,
Lehmann
P.
,
Betz
R. C.
(
2009
).
Novel mutations in the P2RY5 gene in one Turkish and two Indian patients presenting with hypotrichosis and woolly hair
.
Arch. Dermatol. Res.
301
,
621
624
.
Pownall
M. E.
,
Isaacs
H. V.
(
2010
).
FGF Signalling in Vertebrate Development
.
San Rafael, CA, USA
:
Morgan & Claypool Life Sciences
.
Shanmugalingam
S.
,
Houart
C.
,
Picker
A.
,
Reifers
F.
,
Macdonald
R.
,
Barth
A.
,
Griffin
K.
,
Brand
M.
,
Wilson
S. W.
(
2000
).
Ace/Fgf8 is required for forebrain commissure formation and patterning of the telencephalon
.
Development
127
,
2549
2561
.
Shimamura
K.
,
Rubenstein
J. L.
(
1997
).
Inductive interactions direct early regionalization of the mouse forebrain
.
Development
124
,
2709
2718
.
Shimomura
Y.
,
Wajid
M.
,
Ishii
Y.
,
Shapiro
L.
,
Petukhova
L.
,
Gordon
D.
,
Christiano
A. M.
(
2008
).
Disruption of P2RY5, an orphan G protein-coupled receptor, underlies autosomal recessive woolly hair
.
Nat. Genet.
40
,
335
339
.
Shimomura
Y.
,
Garzon
M. C.
,
Kristal
L.
,
Shapiro
L.
,
Christiano
A. M.
(
2009a
).
Autosomal recessive woolly hair with hypotrichosis caused by a novel homozygous mutation in the P2RY5 gene
.
Exp. Dermatol.
18
,
218
221
.
Shimomura
Y.
,
Wajid
M.
,
Petukhova
L.
,
Shapiro
L.
,
Christiano
A. M.
(
2009b
).
Mutations in the lipase H gene underlie autosomal recessive woolly hair/hypotrichosis
.
J. Invest. Dermatol.
129
,
622
628
.
Sive
H. L.
,
Grainger
R. M.
,
Harland
R. M.
(
2000
).
Early Development of Xenopus laevis: a Laboratory Manual
.
Cold Spring Harbor, NY
:
Cold Spring Harbor Laboratory Press
.
Skoura
A.
,
Hla
T.
(
2009
).
Lysophospholipid receptors in vertebrate development, physiology, and pathology
.
J. Lipid Res.
50
Suppl.
,
S293
S298
.
Small
E. M.
,
Vokes
S. A.
,
Garriock
R. J.
,
Li
D.
,
Krieg
P. A.
(
2000
).
Developmental expression of the Xenopus Nkx2-1 and Nkx2-4 genes
.
Mech. Dev.
96
,
259
262
.
Smith
J. C.
,
Price
B. M.
,
Van Nimmen
K.
,
Huylebroeck
D.
(
1990
).
Identification of a potent Xenopus mesoderm-inducing factor as a homologue of activin A
.
Nature
345
,
729
731
.
Standley
H. J.
,
Zorn
A. M.
,
Gurdon
J. B.
(
2001
).
eFGF and its mode of action in the community effect during Xenopus myogenesis
.
Development
128
,
1347
1357
.
Tokumura
A.
,
Majima
E.
,
Kariya
Y.
,
Tominaga
K.
,
Kogure
K.
,
Yasuda
K.
,
Fukuzawa
K.
(
2002
).
Identification of human plasma lysophospholipase D, a lysophosphatidic acid-producing enzyme, as autotaxin, a multifunctional phosphodiesterase
.
J. Biol. Chem.
277
,
39436
39442
.
Umezu-Goto
M.
,
Kishi
Y.
,
Taira
A.
,
Hama
K.
,
Dohmae
N.
,
Takio
K.
,
Yamori
T.
,
Mills
G. B.
,
Inoue
K.
,
Aoki
J.
, et al. 
. (
2002
).
Autotaxin has lysophospholipase D activity leading to tumor cell growth and motility by lysophosphatidic acid production
.
J. Cell Biol.
158
,
227
233
.
van Meeteren
L. A.
,
Ruurs
P.
,
Stortelers
C.
,
Bouwman
P.
,
van Rooijen
M. A.
,
Pradère
J. P.
,
Pettit
T. R.
,
Wakelam
M. J.
,
Saulnier-Blache
J. S.
,
Mummery
C. L.
, et al. 
. (
2006
).
Autotaxin, a secreted lysophospholipase D, is essential for blood vessel formation during development
.
Mol. Cell. Biol.
26
,
5015
5022
.
Wallingford
J. B.
,
Harland
R. M.
(
2002
).
Neural tube closure requires Dishevelled-dependent convergent extension of the midline
.
Development
129
,
5815
5825
.
Walshe
J.
,
Mason
I.
(
2003
).
Unique and combinatorial functions of Fgf3 and Fgf8 during zebrafish forebrain development
.
Development
130
,
4337
4349
.
Webb
T. E.
,
Kaplan
M. G.
,
Barnard
E. A.
(
1996
).
Identification of 6H1 as a P2Y purinoceptor: P2Y5
.
Biochem. Biophys. Res. Commun.
219
,
105
110
.
Wilson
S. W.
,
Houart
C.
(
2004
).
Early steps in the development of the forebrain
.
Dev. Cell
6
,
167
181
.
Yanagida
K.
,
Masago
K.
,
Nakanishi
H.
,
Kihara
Y.
,
Hamano
F.
,
Tajima
Y.
,
Taguchi
R.
,
Shimizu
T.
,
Ishii
S.
(
2009
).
Identification and characterization of a novel lysophosphatidic acid receptor, p2y5/LPA6
.
J. Biol. Chem.
284
,
17731
17741
.
Ye
X.
,
Hama
K.
,
Contos
J. J.
,
Anliker
B.
,
Inoue
A.
,
Skinner
M. K.
,
Suzuki
H.
,
Amano
T.
,
Kennedy
G.
,
Arai
H.
, et al. 
. (
2005
).
LPA3-mediated lysophosphatidic acid signalling in embryo implantation and spacing
.
Nature
435
,
104
108
.

Competing interests

The authors declare no competing financial interests.

Supplementary information