CAPRICE (CPC) encodes a small protein with an R3 MYB motif and promotes root hair cell differentiation in Arabidopsis thaliana. Three additional CPC-like MYB genes, TRY(TRIPTYCHON), ETC1 (ENHANCER OF TRY AND CPC 1) and ETC2 (ENHANCER OF TRY AND CPC 2) act in a redundant manner with CPC in trichome and root hair patterning. In this study, we identified an additional homolog, CPC-LIKE MYB 3 (CPL3),which has high sequence similarity to CPC, TRY, ETC1 and ETC2. Overexpression of CPL3 results in the suppression of trichomes and overproduction of root hairs, as has been observed for CPC,TRY, ETC1 and ETC2. Morphological studies with double, triple and quadruple homolog mutants indicate that the CPL3 gene cooperatively regulates epidermal cell differentiation with other CPChomologs. Promoter-GUS analyses indicate that CPL3 is specifically expressed in leaf epidermal cells, including stomate guard cells. Notably, the CPL3 gene has pleiotropic effects on flowering development, epidermal cell size and trichome branching through the regulation of endoreduplication.

The specification and patterning of cell types is a crucial feature of development in multicellular organisms. In Arabidopsis thaliana, the differentiation of epidermal cells has been used extensively as a relatively simple model for analyzing cell fate specification. Several types of epidermal cells are differentiated in Arabidopsis. For example, root epidermal cells differentiate into either root hair cells or hairless cells(Dolan et al., 1993). Leaf epidermal cells of Arabidopsis can differentiate into trichomes,stomate guard cells and pavement cells. Several regulatory factors are known to be involved in this epidermal cell differentiation. For example, the glabra 2 (gl2) and werewolf (wer) mutant phenotypes show conversion of hairless cells to root hair cells(Masucci et al., 1996; Lee and Schiefelbein, 1999). GL2 encodes a homeodomain leucine-zipper protein, and WERencodes an R2R3-type MYB protein that activates GL2 expression(Rerie et al., 1994; Di Cristina et al., 1996; Masucci et al., 1996; Lee and Schiefelbein, 1999). GLABRA 3 (GL3) and ENHANCER OF GLABRA 3(EGL3) encode basic helix-loop-helix (bHLH) proteins that affect hairless cell differentiation in a redundant manner(Bernhardt et al., 2003). There are two other bHLH genes, AtMYC1(Urao et al., 1996) and TRANSPARENT TESTA 8 (TT8)(Nesi et al., 2000), that are in the same subgroup as GL3 and EGL3(Heim, 2003).

CAPRICE (CPC) encodes a small protein with an R3 MYB motif, and promotes root hair cell differentiation in Arabidopsis(Wada et al., 1997). CPC protein moves from hairless cells to neighboring hair-forming cells and represses expression of GL2 (Wada et al., 2002). Arabidopsis has several additional CPC-like MYB sequences in the Arabidopsis genome, including TRIPTYCHON (TRY), ENHANCER OF TRY AND CPC 1, 2 and 3 (ETC1, ETC2 and ETC3)(Schellmann et al., 2002; Kirik et al., 2004a; Kirik et al., 2004b; Esch et al., 2004; Simon et al., 2007). The clustered trichome phenotype of the try mutant indicates that TRY protein has a regulatory role in trichome formation(Hulskamp et al., 1994; Schellmann et al., 2002). ETC1 and ETC2 have been characterized and their relationship with CPC and TRY genetically examined(Kirik et al., 2004a; Kirik et al., 2004b; Esch et al., 2004). We have recently identified a fourth CPC-like MYB, At4g01060, independently of Simon et al. (Simon et al.,2007), and have named it CPC-LIKE MYB 3(CPL3).

Here, we examine the functions of the CPL3 gene in Arabidopsis. CPL3 redundantly regulates root hair and trichome development along with other CPC homologs. Notably, among the homologs, only CPL3 has pleiotropic effects on flowering development and epidermal cell size through the regulation of endoreduplication.

Plant materials and growth conditions

The Arabidopsis thaliana Col-0 ecotype was used as wild type. The cpc-2 mutant used in this study was described previously(Kurata et al., 2005). The cpl3-1 mutant was isolated from a Wisconsin T-DNA population. We backcrossed cpl3-1 to wild type and confirmed that all of the phenotypes associated with cpl3-1 co-segregate with the T-DNA insertion. We isolated the try-29760, etc1-1 and etc2-2mutants from a SALK T-DNA population. All mutants were in the Col-0 background. Double, triple and quadruple mutants of cpc, try, etc1,etc2 and cpl3 were screened from F2 progeny using PCR to identify homozygous cpc-2, try-29760, etc1-1, etc2-2 and cpl3-1 plants. Selected double, triple and quadruple mutants were checked and documented in the F3 generation. The 35S::CPCand CPCp::GUS transgenic lines were described previously(Wada et al., 1997; Wada et al., 2002). Seeds were surface-sterilized and sown on 1.5% agar plates as described previously(Okada and Shimura, 1990) and grown out for observation of seedling phenotypes. Seeded plates were kept at 4°C for 2 days and then incubated at 22°C under constant white light. For each mutant line, at least ten individual 5-day-old seedlings were assayed for root epidermis changes, and at least five 2-week-old third leaves were assayed for trichomes. Plants were grown in soil at 22°C under continuous light for determining flowering time, leaf size and ploidy. For flowering-related gene expression analyses (CO, FT and SOC1), plants were grown in soil under long-day conditions (16 hours light/8 hours dark).

Gene constructs

Primers

Primer sequences are listed in Table 1.

Table 1.

Primers used in this study

PrimerSequence (5′ to 3′)
TW1167 ATATGGTACCTTTAACATAGAAACCGAC 
TW1168 ATATGTCGACATCTACGACTTAGCTTC 
RT46 GGCCAGTCGACAGAAAACTCACTCACTATTCACATC 
RT47 CGAGGATCCACGCTGCGTATTCATCTCAA 
RT48 GGCCAGTCGACGCTTGGCTAGCTCATAAACG 
RT49 CGATCTAGAACGGTTGGTATTATCCATAACTACT 
RT50 GGCCAGTCGACCAGCCCTGAAAACAGCTAAGAA 
RT51 CGAGGATCCGCGATGGTTATCCATGTCAAAC 
RT71 ATATGTCGACCAGCCCTGAAAACAGCTAAGAA 
RT72 ATATGATATCATTTTTCATGACCCAAAACCTCT 
RT88 ATATGGATCCACGGTCAGTGTTATCCATTACTATT 
RT89 ATATGTCGACCTCAATATATCAAATTCAAACATTCA 
RT126 GATAACCATCGCAGGACTAAGC 
RT127 TACAACGGAATATAATCGAAACAATC 
EF1α-F ATGCCCCAGGACATCGTGATTTCAT 
EF1α-R TTGGCGGCACCCTTAGCTGGATCA 
GUS+00+ ATGTTACGTCCTGTAGAAACCCCAA 
GUS+09− CGTGCACCATCAGCACGTTAT 
CycA2;1-F CGCTTCAGCGGTTTTCTTAG 
CycA2;1-R ATCCTCCATTGCAAGTACCG 
CycA2;2-F TGTATGTGTTGGCCGTAATG 
CycA2;2-R TGGTGTCTCTTGCATGCTTA 
CycA2;3-F CTCTATGCCCCTGAAATCCA 
CycA2;3-R ACCTCCACAAGCAATCAAC 
CycA2;4-F CAAAGCCTCCGATCTCAAAG 
CycA2;4-R CTTGTCCGGTAGCTCTCCAG 
CycA1;1-F CGATGACGAAGAAACGAGCA 
CycA1;1-R TGGCATTAACGCAAACACTTG 
Act2-F CTGGATCGGTGGTTCCATTC 
Act2-R CCTGGACCTGCCTCATCATAC 
SIM-F TTCCGACCACAAGATTCCTC 
SIM-R AGAAGAACCGCTCGATCTCA 
CO-F TGGCTCCTCAGGGACTCACTACAA 
CO-R TTGACTCCGGCACAACACCAGT 
FT-F GATACGAGTAACGAACGGTGAT 
FT-R CCCCCTCTCATTTTTATTACAC 
SOC1-F ATGAATTCGCCAGCTCCAAT 
SOC1-R GCTTCATATTTCAAATGCTGCA 
PrimerSequence (5′ to 3′)
TW1167 ATATGGTACCTTTAACATAGAAACCGAC 
TW1168 ATATGTCGACATCTACGACTTAGCTTC 
RT46 GGCCAGTCGACAGAAAACTCACTCACTATTCACATC 
RT47 CGAGGATCCACGCTGCGTATTCATCTCAA 
RT48 GGCCAGTCGACGCTTGGCTAGCTCATAAACG 
RT49 CGATCTAGAACGGTTGGTATTATCCATAACTACT 
RT50 GGCCAGTCGACCAGCCCTGAAAACAGCTAAGAA 
RT51 CGAGGATCCGCGATGGTTATCCATGTCAAAC 
RT71 ATATGTCGACCAGCCCTGAAAACAGCTAAGAA 
RT72 ATATGATATCATTTTTCATGACCCAAAACCTCT 
RT88 ATATGGATCCACGGTCAGTGTTATCCATTACTATT 
RT89 ATATGTCGACCTCAATATATCAAATTCAAACATTCA 
RT126 GATAACCATCGCAGGACTAAGC 
RT127 TACAACGGAATATAATCGAAACAATC 
EF1α-F ATGCCCCAGGACATCGTGATTTCAT 
EF1α-R TTGGCGGCACCCTTAGCTGGATCA 
GUS+00+ ATGTTACGTCCTGTAGAAACCCCAA 
GUS+09− CGTGCACCATCAGCACGTTAT 
CycA2;1-F CGCTTCAGCGGTTTTCTTAG 
CycA2;1-R ATCCTCCATTGCAAGTACCG 
CycA2;2-F TGTATGTGTTGGCCGTAATG 
CycA2;2-R TGGTGTCTCTTGCATGCTTA 
CycA2;3-F CTCTATGCCCCTGAAATCCA 
CycA2;3-R ACCTCCACAAGCAATCAAC 
CycA2;4-F CAAAGCCTCCGATCTCAAAG 
CycA2;4-R CTTGTCCGGTAGCTCTCCAG 
CycA1;1-F CGATGACGAAGAAACGAGCA 
CycA1;1-R TGGCATTAACGCAAACACTTG 
Act2-F CTGGATCGGTGGTTCCATTC 
Act2-R CCTGGACCTGCCTCATCATAC 
SIM-F TTCCGACCACAAGATTCCTC 
SIM-R AGAAGAACCGCTCGATCTCA 
CO-F TGGCTCCTCAGGGACTCACTACAA 
CO-R TTGACTCCGGCACAACACCAGT 
FT-F GATACGAGTAACGAACGGTGAT 
FT-R CCCCCTCTCATTTTTATTACAC 
SOC1-F ATGAATTCGCCAGCTCCAAT 
SOC1-R GCTTCATATTTCAAATGCTGCA 

35S::CPL3 construct

A 0.8 kb PCR-amplified linear CPL3 genomic fragment (primers TW1167/TW1168) was subcloned into pBluescript SK+ (pBS; Stratagene)using Pyrobest DNA polymerase (Takara, Tokyo, Japan) to make pBS-CPL3. Next, the Acc65I to SalI fragment of pBS-CPL3 was ligated into the Acc65I and SalI sites of the pCHF3 binary vector(Jarvis et al., 1998) to create 35S::CPL3. PCR-generated constructs were completely sequenced following isolation of the clones to check for amplification-induced errors. Finally, the amplified and ligated constructs were cloned into transformation vector pJHA212K (Yoo et al.,2005).

CPL3p::CPL3:GFP constructs

A 3.0 kb PCR-amplified linear CPL3 genomic fragment (primers RT71/RT72) was digested with SalI and EcoRV and ligated into the SalI and EcoRV sites of pBS-2xGFP(Kurata et al., 2005) to create pBS-CPL3:2xGFP. PCR-generated constructs were completely sequenced following isolation of the clones to check for amplification-induced errors. Finally, the SalI to SacI fragment of pBS-CPL3:2xGFP was ligated into the SalI and SacI sites of the pJHA212K binary vector(Yoo et al., 2005) to create CPL3p::CPL3:GFP.

CPL3p::GUS constructs

A 2.4 kb PCR-amplified promoter region of CPL3 (primers RT50/RT51)was digested with NotI and AccI and subcloned into pBS to create pBS-CPL3p. PCR-generated constructs were completely sequenced following isolation of the clones to check for amplification-induced errors. The SalI and BamHI-digested fragment of pBS-CPL3p was ligated into the SalI and BamHI sites of binary vector pBI101 (Clontech Laboratories,CA) to create the CPL3p::GUS construct.

Promoter::GUS constructs

A 1.9 kb PCR-amplified promoter region of ETC1 (primers RT46/RT47), a 3.0 kb PCR-amplified promoter region of ETC2 (primers RT48/RT49) and a 3.0 kb PCR-amplified promoter region of TRY (primers RT88/RT89), were digested with NotI and AccI and subcloned into pBS to create pBS-ETC1, -ETC2 and -TRY. The SalI and BamHI-digested fragment of pBS-ETC1 was ligated into the SalI and BamHI sites of binary vector pBI101 (Clontech Laboratories) to create ETC1p::GUS. The SalI and XbaI-digested fragments of pBS-ETC2 and pBS-TRY were ligated into SalI and XbaI of binary vector pBI101 to create ETC2p::GUS and TRYp::GUSconstructs. At least three T3 lines were isolated on the basis of their segregation ratios for kanamycin resistance for each transgenic line.

Transgenic plants

Plant transformation was performed by a floral dip method(Clough and Bent, 1998), and transformants were selected on a 0.5×MS agar plates containing 50 mg/l kanamycin. Homozygous transgenic lines were selected by kanamycin resistance. We isolated at least twelve T1 lines for each construct and selected at least six T2 and three T3 lines on the basis of their segregation ratios for kanamycin resistance. For each transgenic line, at least ten individual 5-day-old seedlings were assayed for root hair numbers, and at least five 2-week-old third leaves were assayed for trichome numbers. Promoter::GUS transgenic lines were analyzed by PCR (primers GUS+00+/GUS+09-). At least three individual plants were assayed for GUS activity in each of the three transgenic lines. The CPL3p::GUSconstruct was introduced into the cpc-2, try-29760, etc1-1, etc2-1and cpl3-1 mutants by conventional crosses and F2 seedlings were analyzed by PCR. At least five plants from each transgenic line were assayed for GUS activity.

Histology

Promoter::GUS plants were excised from the growth medium and immersed in X-Gluc solution containing 1.0 mM X-Gluc(5-bromo-4-chloro-3-indolyl-β-glucuronide), 1.0 mM K3Fe(CN)6, 1.0 mM K4Fe(CN)6, 100 mM NaPi (pH 7.0), 100 mM EDTA and 0.1% Triton X-100. Primary roots of 5-day-old seedlings were incubated at 37°C overnight. Cotyledons of 5-day-old seedlings, 2-week-old rosette leaves and hypocotyls, and 4-week-old inflorescences and siliques were incubated at 37°C for 3.5 hours.

In situ hybridization

In situ hybridization was as described(Kurata et al., 2003). DIG-labeled antisense RNA probes for CPC, ETC1, ETC2 and CPL3 were generated by transcribing pBS-cDNA (pBS-CPC, -ETC1, -ETC2 and -CPL3) digested with HindIII, SpeI, XhoI and SpeI, respectively. T3 polymerase was used for CPC, ETC1 and CPL3 probes, T7 polymerase for the ETC2 probe.

Semi-quantitative RT-PCR

RNA extraction and semi-quantitative RT-PCR reactions were as described(Kurata et al., 2003). The CPL3 fragment was amplified with the RT73/RT92 primer pair. EF (At1g07930) was amplified with the EF1α-F/EF1α-R primer pair as described (Kurata et al.,2005).

Real-time PCR

Total RNA was extracted using the RNeasy Plant Mini Kit (Qiagen). On-column DNase I digestion was performed during RNA purification following the protocol described in the RNeasy Mini Kit handbook. First-strand cDNA was synthesized from 1 μg total RNA in a 20 μl reaction mixture using the Prime Script RT Regent Kit (Takara). Real-time PCR was performed in a Chromo4 Real-Time PCR Detection System (Bio-Rad, Hercules, CA) using SYBR Premix Ex Taq (Takara). PCR amplification employed a 30 second denaturing step at 95°C, followed by 5 seconds at 95°C and 30 seconds at 60°C with 45 cycles for CPL3 and 40 cycles for CYCA2;1, CYCA2;2, CYCA2;3,CYCA2;4, CYCA1;1, SIM, CO, FT, SOC1 and ACT2. Relative mRNA levels were calculated by iQ5 software (Bio-Rad), and normalized to the concentration of ACT2 mRNA. The primers were: CYCA2;1-F and CYCA2;1-R for CYCA2;1; CYCA2;2-F and CYCA2;2-R for CYCA2;2; CYCA2;3-F and CYCA2;3-R for CYCA2;3; CYCA2;4-F and CYCA2;4-R for CYCA2;4; CYCA1;1-F and CYCA1;1-R for CYCA1;1; SIM-F and SIM-R for SIM; CO-F and CO-R for CO; FT-Fand FT-R for FT; SOC1-F and SOC1-R for SOC1; and ACT2-F and ACT2-R for ACT2(Czechowski et al., 2004; Huang et al., 2005; Yoshizumi et al., 2006).

Fig. 1.

Gene structure and amino acid sequences of Arabidopsis CPC homologs. (A) Sequence alignment of CPC-homologous MYB proteins(CPL3, CPC, TRY, ETC1, ETC2, Os01g43180 and Os01g43230). Red outlined letters indicate identical residues. (B) Phylogenetic tree based on the amino acid sequences. Numbers above branches are genetic distances based on 10,000 bootstrap replicates. The tree was obtained by the neighbor-joining method using Genetyx ver. 11.2.7 software (Genetyx, Tokyo, Japan). (C)Structure of CPC-homologous genes and positions of mutations. The locations of start and stop codons are indicated. Three exon (boxes) and two intron (lines) positions were determined by comparing the genomic sequences with the cDNA sequences. Positions of T-DNA insertions and the identity of mutations are indicated (cpc-2, try-029760, etc1-1, etc2-2 and cpl3-1). (D) Semi-quantitative RT-PCR analysis of CPL3. EF (At1g07930) was used as a control.

Fig. 1.

Gene structure and amino acid sequences of Arabidopsis CPC homologs. (A) Sequence alignment of CPC-homologous MYB proteins(CPL3, CPC, TRY, ETC1, ETC2, Os01g43180 and Os01g43230). Red outlined letters indicate identical residues. (B) Phylogenetic tree based on the amino acid sequences. Numbers above branches are genetic distances based on 10,000 bootstrap replicates. The tree was obtained by the neighbor-joining method using Genetyx ver. 11.2.7 software (Genetyx, Tokyo, Japan). (C)Structure of CPC-homologous genes and positions of mutations. The locations of start and stop codons are indicated. Three exon (boxes) and two intron (lines) positions were determined by comparing the genomic sequences with the cDNA sequences. Positions of T-DNA insertions and the identity of mutations are indicated (cpc-2, try-029760, etc1-1, etc2-2 and cpl3-1). (D) Semi-quantitative RT-PCR analysis of CPL3. EF (At1g07930) was used as a control.

ANOVA (analysis of variance) was performed to determine the significance of differences between cpl3, 35S::CPL3 or CPL3p::CPL3, and wild type.

Ploidy analysis

Nuclei were extracted and stained with CyStain UV Precise P (Partec,Münster, Germany) following the manufacturer's protocol. Flow cytometric analysis was performed by a Ploidy Analyzer PA flow cytometer (Partec),according to the manufacturer's instructions.

Microscopy

Light microscopy

Root phenotypes were observed using an Olympus Provis AX70 microscope and an Olympus SZH binocular microscope. For each mutant or transgenic line, at least ten individual 5-day-old seedlings were analyzed for root hair number and root GUS activity. For the observation of trichomes, images were recorded with a VC4500 3D digital fine microscope (Omron, Kyoto, Japan) or digital microscope (VH-8000; Keyence, Osaka, Japan). At least five 2-week-old third true leaves were analyzed for trichome number and GUS activity for each mutant or transgenic line. For measurement of epidermal cell numbers, five 2-week-old third leaves were cleared with chloral hydrate:glycerol:water (8:2:1, w:v:v)(Yadegari et al., 1994), and visualized using a Zeiss Axio-plan2 microscope (Carl Zeiss, Germany).

Confocal laser scanning microscopy (CLSM)

CPL3p::CPL3:GFP transgenic lines were stained with 5 μg/ml propidium iodide (PI) for 30 seconds and mounted in water. Confocal images were obtained with a 40× water-immersion objective on a Zeiss LSM-Pascal or a Zeiss LSM-510 Meta confocal laser scanning microscope using 488 nm laser lines for GFP excitation. Image processing was with Photoshop version 7.0(Adobe Systems, CA).

Scanning electron microscopy (SEM)

To observe the phenotype of trichomes, rosette leaves or inflorescences were attached to the stage and cooled in liquid nitrogen. Observations were made in low vacuum with a scanning electron microscope (model JSM5610-LV;JEOL, Akishima, Japan).

Yeast two-hybrid assay

Vectors and yeast strains were obtained from Clontech (Mountain View, CA;MATCHMAKER Two-Hybrid System). CPC, TRY, ETC1, ETC2 and CPL3 full-length proteins were fused to the GAL4 DNA-binding domain in pGBT9. GL3, EGL3, AtMYC1 and TT8 full-length proteins were fused with the GAL4 activation domain in pGAD424. Yeast strain Y187 was transformed with the appropriate plasmids using carrier DNA and the lithium acetate method(Kallal and Kurjan, 1997). Following the Yeast Protocols Handbook (Clontech), a β-galactosidase assay was performed on each transformant using O-nitrophenylβ-d-galactopyranoside (Sigma) as substrate.

Fig. 2.

Phenotypes associated with CPC-homolog gain- and loss-of-function mutants. (A-L) Root hair formation of a 5-day-old Arabidopsis seedling showing no root hair phenotype (G,H), reduced number of root hairs (B,C) and increased number of root hairs (I-L).(M-X) Trichome formation on the 2-week-old third leaves showing increased number of trichomes (N-T). No trichome formation was observed in gain-of-function plants (U-X). Scale bars: 100 μm in A for A-L; 1 mm in M-X.

Fig. 2.

Phenotypes associated with CPC-homolog gain- and loss-of-function mutants. (A-L) Root hair formation of a 5-day-old Arabidopsis seedling showing no root hair phenotype (G,H), reduced number of root hairs (B,C) and increased number of root hairs (I-L).(M-X) Trichome formation on the 2-week-old third leaves showing increased number of trichomes (N-T). No trichome formation was observed in gain-of-function plants (U-X). Scale bars: 100 μm in A for A-L; 1 mm in M-X.

Identification of the CPL3 gene

A search of the Arabidopsis genome sequence revealed four MYB gene sequences with high homology to CPC: TRY, ETC1, ETC2 and CPL3. The CPL3-encoded protein is closely related to the proteins encoded by CPC-like MYB family members CPC, TRY,ETC1 and ETC2, and two rice (Oryza sativa) homologs,Os01g43180 and Os01g43230 (Fig. 1A). A phylogenetic tree based on the alignment of amino acid sequences with the R2R3-type MYB family members WER, GL1 and MYB23, indicated that the two rice homologs are more closely related to the CPC-like MYB family than to the R2R3-type MYB family, and that CPL3 is more closely related to ETC1 than to the other CPC-homologous proteins(Fig. 1B).

To assess the function of the CPL3 gene, we identified a T-DNA mutant allele, cpl3-1, in the Wisconsin T-DNA collection. cpl3 plants have a T-DNA insertion in the first exon(Fig. 1C). Using semi-quantitative RT-PCR, no CPL3 mRNA could be detected in the cpl3 mutant, indicating that transcription of the CPL3 gene is disrupted by the T-DNA insertion (Fig. 1D). We also screened several T-DNA-tagged pools for knockouts of CPC-like MYB genes, and identified the mutant lines etc1-1(Kirik et al., 2004a) and etc2-2. Additionally, ecotype Col-0 alleles of cpc and try mutants were found and named cpc-2(Kurata et al., 2005) and try-029760. Thus, all of the mutants used in this study are in a Col-0 background.

Epidermis phenotypes of CPL3 loss-of-function mutants

The root hair phenotype of the cpc-1 (WS background)(Wada et al., 1997) and cpc-2 (Col-0 background) mutant lines is characterized by the formation of approximately one-fourth as many root hairs as the wild type (see Fig. S1A in the supplementary material), respectively. In the cpl3-1line, the relative number of root hairs was about 80% that of wild type(Fig. 2B, Table 2). There is a distinct possibility that functional redundancy provided by the presence of similar genes obscures the phenotype of each individual knockout mutant. Therefore, we made cpl3 double mutants with each of the other CPC-like MYB mutants (Table 2). It had already been reported that the cpc-1 try-82 and cpc-1 etc1-1double mutants have very few root hairs(Schellmann et al., 2002; Kirik et al., 2004b). We confirmed these observations using the cpc-2, try-29760 and etc1-1 alleles (see Fig. S1A in the supplementary material). Root hair production in the cpl3 cpc double mutant was about 50% of that in the cpc single mutant (see Fig. S1A in the supplementary material). However, root hair production in cpl3 try, cpl3 etc1 and cpl3 etc2 double mutants was not significantly different to that in wild type (Table 2).

Table 2.

Phenotypes of root epidermal cells

GenotypeLength of epidermal cell (μm)Number of root hairs per mmRelative hair number*
Col-0 180±10 41.3±4.3 74.2 
cpl3 192±5 31.1±1.1 59.7 
cpl3 cpc 182±7 6.0±0.8 10.9 
cpl3 try 183±9 43.6±0.8 79.8 
cpl3 etc1 189±7 41.5±0.8 78.4 
cpl3 etc2 193±18 38.4±1.5 74.1 
35S::CPL3#1 156±6 57.2±3.9 89.2 
35S::CPL3#2 151±12 65.4±4.1 98.8 
CPL3p::CPL3#1 171±14 46.8±1.1 80.0 
CPL3p::CPL3#2 166±13 50.9±1.4 84.5 
GenotypeLength of epidermal cell (μm)Number of root hairs per mmRelative hair number*
Col-0 180±10 41.3±4.3 74.2 
cpl3 192±5 31.1±1.1 59.7 
cpl3 cpc 182±7 6.0±0.8 10.9 
cpl3 try 183±9 43.6±0.8 79.8 
cpl3 etc1 189±7 41.5±0.8 78.4 
cpl3 etc2 193±18 38.4±1.5 74.1 
35S::CPL3#1 156±6 57.2±3.9 89.2 
35S::CPL3#2 151±12 65.4±4.1 98.8 
CPL3p::CPL3#1 171±14 46.8±1.1 80.0 
CPL3p::CPL3#2 166±13 50.9±1.4 84.5 

Data, including s.d., were obtained from at least ten 5-day-old roots from each line.

*

Relative hair number indicates the number of root hairs formed on a segment of root with average length epidermal cells calculated from [length of epidermal cell (μm) × number of root hairs per mm]/100.

Trichome formation in the double mutants is more complicated than root hair formation because of the three developmental aspects of trichome formation:number, clustering and branching. There were more trichomes on cpc-2than on wild type (see Fig. S1B in the supplementary material), as had been reported using the WS allele, cpc-1(Schellmann et al., 2002). As was the case with cpc mutant alleles, cpl3 plants also had more trichomes: roughly 80% more than wild type(Table 3, Fig. 2N). The cpl3 cpcand cpl3 etc2 double mutants had more trichomes than the parental single-mutant lines (Table 3, Fig. 2O,Q). The combination of try-EM1 (Folkers et al.,1997) with cpc-1 resulted in an increase in trichome clustering (Schellmann et al.,2002). The cpl3 try double mutant had a slightly increased percentage of clustered trichomes compared with the trysingle mutant (Table 3). By contrast, there were no clusters on the cpl3 single mutant, cpl3 cpc, cpl3 etc1, or cpl3 etc2 double mutants(Fig. 2N,O,Q, Table 3).

Table 3.

Leaf trichome number and cluster formation

GenotypeTrichomes per leaf% Trichomes in clusters
Col-0 39.4±3.6 
cpl3 72.5±4.6 
try 42.4±2.8 23.7±3.6 
cpl3 try 53.3±1.8 29.9±3.2 
cpl3 cpc 106.3±9.3 
cpl3 etc1 67.4±4.2 
cpl3 etc2 94.6±3.4 
cpl3 try etc1 68.2±3.5 55.4±6.2 
35S::CPL3#1 
35S::CPL3#2 
CPL3p::CPL3#1 
CPL3p::CPL3#2 
GenotypeTrichomes per leaf% Trichomes in clusters
Col-0 39.4±3.6 
cpl3 72.5±4.6 
try 42.4±2.8 23.7±3.6 
cpl3 try 53.3±1.8 29.9±3.2 
cpl3 cpc 106.3±9.3 
cpl3 etc1 67.4±4.2 
cpl3 etc2 94.6±3.4 
cpl3 try etc1 68.2±3.5 55.4±6.2 
35S::CPL3#1 
35S::CPL3#2 
CPL3p::CPL3#1 
CPL3p::CPL3#2 

Data, including s.d., were obtained from at least ten 2-week-old third leaves from each line.

Fig. 3.

cpl3 cpc try etc1 quadruple mutant phenotype. (A)The adaxial surface of rosette leaf of a cpl3 cpc try etc1 quadruple mutant Arabidopsis was entirely covered by trichomes. (B)Pistil and stamen of a cpl3 cpc try etc1 quadruple mutant were surrounded by trichomes. (C) Adaxial epidermis of a rosette leaf of the cpl3 cpc try etc1 quadruple mutant. (D) Trichome phenotypes of a cpl3 cpc try etc1 quadruple mutant. Trichome phenotype of Col-0(E) and cpl3 mutant (F). Scale bars: 200 μm in A;100 μm in B-F.

Fig. 3.

cpl3 cpc try etc1 quadruple mutant phenotype. (A)The adaxial surface of rosette leaf of a cpl3 cpc try etc1 quadruple mutant Arabidopsis was entirely covered by trichomes. (B)Pistil and stamen of a cpl3 cpc try etc1 quadruple mutant were surrounded by trichomes. (C) Adaxial epidermis of a rosette leaf of the cpl3 cpc try etc1 quadruple mutant. (D) Trichome phenotypes of a cpl3 cpc try etc1 quadruple mutant. Trichome phenotype of Col-0(E) and cpl3 mutant (F). Scale bars: 200 μm in A;100 μm in B-F.

The etc1-1 try-82 cpc-1 triple mutant produced a large number of trichomes (Kirik et al.,2004b). In our experiment, the cpl3 try etc1 triple mutant had more clusters, though the trichome number was similar to that of cpl3 (Fig. 2R, Table 3). The cpl3 cpc try triple mutant had a more extreme phenotype, with heavy marginal clusters (Fig. 2S). Each cluster in cpl3 cpc try was larger than any on cpc try, but it was difficult to distinguish individual trichomes so they could not be accurately counted (see Fig. S2 in the supplementary material). The leaves of the cpl3 cpc try etc1 quadruple mutant were entirely covered by trichomes (Fig. 2T), which is similar to that seen in the transformant line 35S:GL1 35S:R(Larkin et al., 1994). Unlike the etc1-1 try-82 cpc-1 triple mutant(Kirik et al., 2004b), the cpl3 cpc try etc1 quadruple mutant developed a large trichome cluster covering even the midvein. Almost all of the adaxial epidermal cells appeared to have differentiated into trichomes (Fig. 3A). Differential interference contrast (DIC) images of the quadruple mutant showed that the epidermal layer was completely made up of trichome cells, to the exclusion of pavement cells, socket cells and guard cells (Fig. 3C). Hypocotyls and inflorescences were also covered with trichomes(Fig. 3B and see Fig. S3A in the supplementary material), and almost every hypocotyl epidermal cell had differentiated into trichomes (see Fig. S3B in the supplementary material). SEM images of the adaxial surface of a true leaf showed that there was a large variation in the size and branch number of individual trichomes on the quadruple mutant (Fig. 3D).

try mutant trichomes have increased DNA content and more branches than wild type (Hulskamp et al.,1994). By contrast, cpl3 mutant trichomes had consistently fewer branches than wild type, with 55% of cpl3trichomes having two branches (Table 4, Fig. 3E,F). These trichome phenotypes were also found on plants grown in soil (see Fig. S4 in the supplementary material). Double mutants with cpl3 and the other CPC homologs did not significantly further reduce the branching observed in cpl3 (Table 4).

Table 4.

Trichome branch numbers

Branches (br)/Trichome (%)
Genotype1 br2 br3 br4 br5 br6 br
Col-0 2±1 13±2 82±3 3±1 
cpl3 10±1 55±2 35±1 
try 2±1 55±3 33±2 10±2 1±0.4 
cpl3 try 1±0.3 4±1 53±3 36±3 7±1 
cpl3 cpc 9±1 37±2 54±2 
cpl3 etc1 3±1 51±8 46±6 
cpl3 etc2 10±1 49±2 41±2 
Branches (br)/Trichome (%)
Genotype1 br2 br3 br4 br5 br6 br
Col-0 2±1 13±2 82±3 3±1 
cpl3 10±1 55±2 35±1 
try 2±1 55±3 33±2 10±2 1±0.4 
cpl3 try 1±0.3 4±1 53±3 36±3 7±1 
cpl3 cpc 9±1 37±2 54±2 
cpl3 etc1 3±1 51±8 46±6 
cpl3 etc2 10±1 49±2 41±2 

Data, including s.d., were obtained from at least five 2-week-old third leaves from each line.

CPL3 has a similar function to CPC, TRY, ETC1 and ETC2

CPL3 was expressed under the control of the 35S promoter to produce an overexpressing line for comparison with the 35S::CPC, 35S::TRY,35S::ETC1 and 35S::ETC2 lines(Wada et al., 1997; Schellmann et al., 2002; Kirik et al., 2004a; Kirik et al., 2004b). As with the overexpression lines of its homologs, 35S::CPL3 had more than the normal number of root hairs, and no trichomes(Fig. 2I,J,U,V, Tables 2, 3, and see Fig. S5 in the supplementary material). These results indicate that each of the CPC-like MYB homologs has a similar function for root hair and trichome formation when overexpressed under the control of the 35S promoter. When the CPL3 gene's own promoter was used to increase CPL3expression (CPL3p::CPL3), a relatively small amount of ectopic root hair formation was observed (Fig. 2K,L, Table 2, and see Fig. S5A in the supplementary material), and there were no trichomes produced (Fig. 2W,X, Table 3, and see Fig. S5B in the supplementary material).

Fig. 4.

CPL3 gene expression. (A) Real-time PCR analysis of CPL3 gene expression in Arabidopsis organs. Total RNA was isolated from the indicated tissues. (B-E) In situ hybridization patterns of CPC-homologous genes at the shoot apex. Arrowheads in B and C indicate CPC and ETC1 signals evident in young trichomes. No signal for either ETC2 or CPL3 was detected in D and E. (F-M) Activity of CPL3p::GUS reporter in 2-week-old leaves (F), in 5-day-old cotyledons (G), hypocotyls (H) and roots (I), in 4-week-old inflorescence (J,K) and silique (L,M). (N) Localization of CPL3-GFP fusion protein. Fluorescence from the GFP fusion protein (green) and propidium iodide (red) was observed with confocal laser scanning microscopy. CPL3p::CPL3:GFP signal localization in 2-week-old leaves. Scale bars:50 μm in B for B-E and in G,H,N; 100 μm in I; 200 μm in K,M; 1 mm in F,J,L.

Fig. 4.

CPL3 gene expression. (A) Real-time PCR analysis of CPL3 gene expression in Arabidopsis organs. Total RNA was isolated from the indicated tissues. (B-E) In situ hybridization patterns of CPC-homologous genes at the shoot apex. Arrowheads in B and C indicate CPC and ETC1 signals evident in young trichomes. No signal for either ETC2 or CPL3 was detected in D and E. (F-M) Activity of CPL3p::GUS reporter in 2-week-old leaves (F), in 5-day-old cotyledons (G), hypocotyls (H) and roots (I), in 4-week-old inflorescence (J,K) and silique (L,M). (N) Localization of CPL3-GFP fusion protein. Fluorescence from the GFP fusion protein (green) and propidium iodide (red) was observed with confocal laser scanning microscopy. CPL3p::CPL3:GFP signal localization in 2-week-old leaves. Scale bars:50 μm in B for B-E and in G,H,N; 100 μm in I; 200 μm in K,M; 1 mm in F,J,L.

Previous analyses in yeast have shown that CPC protein binds to the bHLH domain of the maize R protein (Wada et al., 2002), and that CPC, TRY, ETC1 and ETC2 bind to the bHLH-domain-containing GL3 protein (Kirik et al., 2004a; Kirik et al.,2004b; Esch et al.,2003). To test whether CPL3 can also interact with GL3, we performed a yeast two-hybrid analysis. All of the CPC homologous proteins(CPC-BD, TRY-BD, ETC1-BD, ETC2-BD and CPL3-BD) bound strongly to GL3-AD, and there also was significant binding to EGL3-AD and AtMYC1-AD (see Fig. S6 in the supplementary material).

Expression pattern of the CPL3 gene

CPL3 expression was examined in plant tissues using real-time PCR. CPL3 was more strongly expressed in shoots (including a few small true leaves) than in roots of seedlings(Fig. 4A). The relatively strong expression of CPL3 in mature plants was specifically observed in siliques and buds (Fig. 4A). Shellman et al. reported that in trichomes, TRY expression was strongest, followed by CPC(Schellmann et al., 2002). In our hands, in situ hybridization of shoot meristem tissue indicated that the expression of CPC was stronger than that of ETC1 in trichomes (Fig. 4B,C). We could not detect ETC2 or CPL3 expression in young trichomes(Fig. 4D,E).

To analyze expression at the cellular level, we made CPL3promoter-GUS fusions. CPL3p::GUS was expressed in young leaves and mostly restricted to stomate guard cells in leaves, cotyledons and hypocotyls(Fig. 4F-H). We could not detect CPL3p::GUS in trichomes. CPL3 was detectable in roots by real-time PCR (Fig. 4A), but no CPL3p::GUS was detected in roots(Fig. 4I). Consistent with real-time PCR, strong CPL3p::GUS expression was observed in inflorescences and developing seeds in siliques(Fig. 4J-M).

Protein localization was determined using protein-2XGFP fusion constructs driven by the CPL3 promoter (Fig. 4N). In CPL3p::CPL3:GFP transgenic plants, a strong GFP signal was observed in the guard cells(Fig. 4N), which was also consistent with the expression pattern of the CPL3p::GUS construct(Fig. 4F). We could not check for GFP localization in trichomes of these transgenic plants because increased CPL3 gene dosage prevents the formation of trichomes(Fig. 2W,X, Table 3, and see Fig. S5B in the supplementary material). There was also no GFP signal in root epidermis of CPL3p::CPL3:GFP plants, which is consistent with the CPL3p::GUS data.

Intriguing features of the CPL3 gene

The guard cell-specific protein localization of CPL3(Fig. 4N) indicates some specific involvement with stomate initiation or development, but there was no difference in the distribution or cluster formation of guard cells among cpl3, 35S::CPL3, CPL3p::CPL3 or wild-type plants(Table 5, and see Tables S1 and S2 in the supplementary material). Also, the double mutant cpl3 etc2did not show any aberrant stomata phenotype (see Table S3 in the supplementary material). Similar to root hairs, stomates of hypocotyls in wild-type Arabidopsis develop from epidermal cells that overlie two cortical cell files (Berger et al.,1998; Hung et al.,1998), a location known as the `S' (stomate) position. Therefore,we also checked the position of stomates on hypocotyls. About 84% of stomates are located in the S position and 16% in the `N' (non-stomate) position in Col-0 plants (Table 6). There was no significant difference in the positions of hypocotyl stomata among cpl3, CPL3p::CPL3 and wild-type plants(Table 6, and see Table S4 in the supplementary material). 35S:CPL3 transgenic lines,however, showed a significant difference in hypocotyl stomate distribution,with 54% of its stomata at the S position and 46% at the N position(Table 6, and see Table S5 in the supplementary material). These observations suggest that CPL3 is involved in the distribution of hypocotyl guard cells.

Table 5.

Stomatal density on cotyledons of the cpl3 mutant and CPL3 overexpressing lines

GenotypeStomata per mm2Stomate index (%)Clusters per mm2
Col 213±14 26.0±1.7 
cpl3 218±11 25.4±0.9 
35S::CPL3#1 256±15 24.1±1.4 
CPL3p::CPL3#1 256±17 27.5±1.5 
GenotypeStomata per mm2Stomate index (%)Clusters per mm2
Col 213±14 26.0±1.7 
cpl3 218±11 25.4±0.9 
35S::CPL3#1 256±15 24.1±1.4 
CPL3p::CPL3#1 256±17 27.5±1.5 

Data represent the mean±s.d. of at least five leaves per experiment.

Table 6.

Effect of CPL3 on hypocotyl stomate patterns

GenotypeNumber of stomataStomata in S position (%)Stomata in N position (%)
Col-0 1.8±0.3 84±12 16±11 
cpl3 1.8±0.4 73±15 27±7 
35S::CPL3#1 2.0±0.4 54±16 46±10 
CPL3p::CPL3#1 2.4±0.4 77±12 23±10 
GenotypeNumber of stomataStomata in S position (%)Stomata in N position (%)
Col-0 1.8±0.3 84±12 16±11 
cpl3 1.8±0.4 73±15 27±7 
35S::CPL3#1 2.0±0.4 54±16 46±10 
CPL3p::CPL3#1 2.4±0.4 77±12 23±10 

Data represent the mean±s.d. of ten hypocotyls per experiment.

Fig. 5.

Expression of flowering-related genes in the cpl3 mutant and transgenic Arabidopsis plants expressing CPL3. Real-time PCR analyses of FT (A), SOC1 (B), CO(C) and CPL3 (D) genes at three developmental stages. Expression levels were normalized to ACT2 expression. Relative expression levels: expression levels of each gene in cpl3, 35S::CPL3and CPL3p::CPL3 relative to wild type at 7 days. RNA was isolated from 7-, 14- and 21-day-old rosette leaves grown under long-day conditions. The experiment was repeated four times. Error bars indicate s.d.

Fig. 5.

Expression of flowering-related genes in the cpl3 mutant and transgenic Arabidopsis plants expressing CPL3. Real-time PCR analyses of FT (A), SOC1 (B), CO(C) and CPL3 (D) genes at three developmental stages. Expression levels were normalized to ACT2 expression. Relative expression levels: expression levels of each gene in cpl3, 35S::CPL3and CPL3p::CPL3 relative to wild type at 7 days. RNA was isolated from 7-, 14- and 21-day-old rosette leaves grown under long-day conditions. The experiment was repeated four times. Error bars indicate s.d.

In addition to the effects on root hair and trichome formation, cpl3 mutant plants were affected in flowering time. As shown in Table 7, cpl3 mutant plants flowered earlier than wild type (28.9±0.5 versus 37.6±0.5 days) and with fewer leaves (8.2±0.3 versus 17.4±0.6). By contrast, cpc, try, etc1 and etc2 mutant plants were not significantly different from wild type(Table 7). 35S::CPL3transgenic plants flowered slightly later than wild type (41.1±1.1 versus 37.6±0.5 days) and with more leaves (28.5±1.7 versus 17.4±0.6) (Table 7, and see Table S6 in the supplementary material). To clarify the effect of the CPL3 gene on flowering, the expression of some flowering-related genes was examined in plant lines with altered CPL3 expression by real-time PCR. FLOWERING LOCUS T (FT), SUPPRESSOR OF OVEREXPRESSION OF CO 1 (SOC1) and CONSTANS(CO) play a central role in controlling floral transition (flowering)(Bagnall, 1993; Lee et al., 2000; Koornneef et al., 1991). Expression of FT and SOC1 were higher in the cpl3mutant than in wild type under long-day (LD) conditions during leaf development (Fig. 5A,B). In 21-day-old leaves, expression of FT was about 9.5-fold higher, and that of SOC1 3.2-fold higher in cpl3 than in wild type(Fig. 5A,B). Expression of CO in cpl3 was not significantly different from that in wild type (Fig. 5C). These results suggest the involvement of CPL3 in flowering regulation by repressing FT and SOC1 expression.

Table 7.

Flowering time and leaf numbers at flowering time of the cpc, try,etc1, etc2 and cpl3 knockout mutants and of the 35S::CPL3-overexpressing transformant line

GenotypeFlowering time (days)Number of leaves
Col-0 37.6±0.5 17.4±0.6 
cpl3 28.9±0.5 8.2±0.3 
cpc 39.6±0.5 19.2±0.6 
try 36.0±0.8 14.3±0.6 
etc1 40.6±0.8 19.3±0.8 
etc2 39.0±0.5 14.1±1.9 
35S::CPL3#1 41.1±1.1 28.5±1.7 
GenotypeFlowering time (days)Number of leaves
Col-0 37.6±0.5 17.4±0.6 
cpl3 28.9±0.5 8.2±0.3 
cpc 39.6±0.5 19.2±0.6 
try 36.0±0.8 14.3±0.6 
etc1 40.6±0.8 19.3±0.8 
etc2 39.0±0.5 14.1±1.9 
35S::CPL3#1 41.1±1.1 28.5±1.7 

Data represent the mean±s.d. of at least ten plants per experiment.

In addition to the altered flowering phenotype, cpl3 mutant plants were much larger and CPL3-overexpressing plants were much smaller than wild type (Fig. 6A). We confirmed this dwarf phenotype of CPL3-overexpressing plants with three 35S::CPL3 and five CPL3p::CPL3 independent transgenic lines. The fresh weight of cpl3 mutants was about 50% greater than that of wild type, and CPL3p::CPL3 plants were about 30% the fresh weight of wild type (Fig. 6B). Leaf epidermal cells in the cpl3 mutant were remarkably larger, and cells from CPL3p::CPL3 were smaller than those of wild type(Fig. 6C-E). This translates into a significant difference in overall plant size. For example, the cpl3 mutant third leaf was about 13% larger, and the CPL3p::CPL3-overexpressing line was about half the size, of wild type. However, there was no significant difference in leaf cell numbers(Table 8). These observations demonstrate that enhanced growth of cpl3 was caused by hypertrophy rather than hyperplasia of leaf cells. In addition, hypocotyl cells and hypocotyls of cpl3 were elongated, but those of 35S::CPL3were rounded, resulting in slightly shortened hypocotyls(Fig. 6F-K).

Table 8.

Number of leaf epidermal cells in the cpl3 knockout mutant and CPL3p::CPL3-overexpressing transformant line

GenotypeLeaf size (mm2)Pavement cells (per mm2)Pavement cells/leaf
Col-0 16.8±0.3 181±19 3035±311 
cpl3 19.0±1.3 158±26 3014±535 
CPL3p::CPL3#1 9.5±0.9 311±14 2960±306 
GenotypeLeaf size (mm2)Pavement cells (per mm2)Pavement cells/leaf
Col-0 16.8±0.3 181±19 3035±311 
cpl3 19.0±1.3 158±26 3014±535 
CPL3p::CPL3#1 9.5±0.9 311±14 2960±306 

Data represent the means±s.d. of five leaves and at least 20 cells per experiment.

Fig. 6.

Phenotypes of cpl3 mutant and transgenic plants expressing CPL3. (A) Soil-grown rosettes from 4-week-old Col-0, cpl3, etc2 cpl3, 35S::CPL3, CPL3p::CPL3#1 and CPL3p::CPL3#2 Arabidopsis plants. (B) Fresh weight of rosette leaves per plant was calculated from the means (±s.d.) of a minimum of five rosettes from each line. (C-E) Microscopic analysis of leaf epidermis of Col-0, cpl3 and CPL3p::CPL3. The study was carried out in the middle region of the leaf blade of 2-week-old plants.(F-H) Hypocotyls from 2-week-old Col-0, cpl3 and 35S::CPL3. (I-K) Hypocotyl epidermis of Col-0, cpl3and 35S::CPL3. Scale bars: 5 mm in A; 100 μm in C,I; 200 μm in F.

Fig. 6.

Phenotypes of cpl3 mutant and transgenic plants expressing CPL3. (A) Soil-grown rosettes from 4-week-old Col-0, cpl3, etc2 cpl3, 35S::CPL3, CPL3p::CPL3#1 and CPL3p::CPL3#2 Arabidopsis plants. (B) Fresh weight of rosette leaves per plant was calculated from the means (±s.d.) of a minimum of five rosettes from each line. (C-E) Microscopic analysis of leaf epidermis of Col-0, cpl3 and CPL3p::CPL3. The study was carried out in the middle region of the leaf blade of 2-week-old plants.(F-H) Hypocotyls from 2-week-old Col-0, cpl3 and 35S::CPL3. (I-K) Hypocotyl epidermis of Col-0, cpl3and 35S::CPL3. Scale bars: 5 mm in A; 100 μm in C,I; 200 μm in F.

Because endoreduplication is generally thought to provide a mechanism for increasing cell size, and the try mutation increases trichome endoreduplication (Szymanski and Marks,1998), we analyzed the ploidy of leaf cells from wild-type, cpl3, 35S::CPL3 and CPL3p::CPL3 plants. In the cpl3mutant, the number of 32C and 16C cells was increased in 16-day-old first leaves (Fig. 7A; the proportions of 32C and 16C were 0% and 26.9% for Col-0, and 2.6% and 29.2% for cpl3, respectively). This result suggests that the altered phenotypes of the cpl3 mutant, including hypertrophic cell growth, are associated with an increase in endoreduplication. By contrast, 35S:CPL3 and CPL3p::CPL3 had reduced DNA levels in 16-day-old first leaves (Fig. 7A; the proportions of 4C and 2C for Col-0 were 19.6% and 16.9%,for 35S::CPL3 24.3% and 27.4%, and for CPL3p::CPL3 33.1% and 26.4%, respectively). In 3-week-old third leaves, the ploidy differences were observed more clearly (Fig. 7B;the proportions of 16C for Col-0, cpl3, 35S::CPL3 and CPL3p::CPL3 were 2.1%, 12.0%, 0.7% and 1.0%, respectively). This study demonstrates that CPL3 is likely to have some role in ploidy-dependent epidermal cell growth in Arabidopsis.

Endoreduplication is a type of cell cycle that skips the cell division steps of mitosis and thus affects cell cycle-related gene expression. We examined the expression of the cell cycle-related genes CYCA2;1, CYCA2;2,CYCA2;3, CYCA2;4 and CYCA1;1, which have been reported to be involved in endoreduplication in Arabidopsis(Yoshizumi et al., 2006; Imai et al., 2006), and of SIM, which is a cell cycle regulator controlling the onset of endoreduplication (Churchman et al.,2006). Expression of these genes in Col-0, cpl3,35S::CPL3 and CPL3p::CPL3 was analyzed by real-time PCR(Fig. 8). Although expression of CYCA2;1 and CYCA2;2 in the cpl3 mutant seemed to be somewhat reduced, and in overexpressers (35S::CPL3 and CPL3p::CPL3) seemed to be increased, compared with wild type(Fig. 8A,B), no significant changes were observed for any of the CYCA genes(Fig. 8A-E). Compared with wild type, expression of SIM was higher in the cpl3 mutant and lower in 35S::CPL3 and CPL3p::CPL3 during leaf development(Fig. 8F). Significant reduction in expression was observed in 30-day-old 35S::CPL3 and 12-day-old CPL3p::CPL3 plants compared with wild type(Fig. 8F). These results suggest that increased ploidy in the cpl3 mutant and decreased ploidy in CPL3 overexpressers are involved in the function of SIM.

Redundancy of CPL3 and CPC-like MYB genes in epidermal differentiation

Historically, cpc was isolated as a mutant with few root hairs(Wada et al., 1997). Although the typical plant MYB gene encodes a R2-R3 type MYB region(Rosinski and Atchley, 1998), CPC encodes a small R3-type MYB of only 94 amino acids. Not long after isolation of CPC, TRY was isolated as a CPC-homologous gene from a trichome-clustering mutant(Schellmann et al., 2002). More recently, ETC1, ETC2 and ETC3 were isolated as enhancers of try and cpc(Kirik et al., 2004a; Kirik et al., 2004b; Esch et al., 2004; Simon et al., 2007). We also independently isolated these three genes by homology with CPC. In this paper, we describe the isolation of CPL3, and provide evidence that it has a redundant function with the other homologs of CPC. In addition to its MYB function, CPL3 has epistatic effects on a number of crucial plant development and growth mechanisms. From the observation of double, triple and quadruple mutant phenotypes, it is clear that CPCplays the dominant role in the regulation of root hair formation, and TRY plays the dominant role in trichome formation, but all five CPC-like MYB genes, including CPL3, have a redundant function in root hair and trichome formation (Figs 2, 3, Tables 2, 3, and see Fig. S1 in the supplementary material). The reduction in root hair number compared with wild type was significant in the cpl3-1 single mutant, but not in cpl3 try, cpl3 etc1 or cpl3 etc2 double mutants(Table 2). Because CPC represses its own expression (Wada et el.,2002), it is possible that CPC-homologous genes also repress CPC expression. Thus, disruption of the other CPC-homologous genes in the cpl3 mutant background may enhance CPC expression, which leads to the formation of many root hairs. The conversion of almost all adaxial surface leaf cells and hypocotyl cells into trichome cells in the cpc try etc1 cpl3 quadruple mutant indicates that CPL3 either directly or indirectly shares a similar function with its homologs, because the cpc try etc1 triple mutant had a number of epidermal cell types other than trichome cells(Fig. 3, and see Fig. S3A in the supplementary material).

Fig. 7.

Loss of CPL3 function increases polyploidy levels.(A) Relative ratios of each cell ploidy of 8- and 16-day-old first leaves of Col-0, cpl3, 35S::CPL3 and CPL3p::CPL3 Arabidopsisplants. (B) Relative ratios of each cell ploidy of 3-week-old third leaves of Col-0, cpl3, 35S::CPL3 and CPL3p::CPL3.Approximately 5000 nuclei were counted in Col-0, cpl3, 35S::CPL3 and CPL3p::CPL3 tissues.

Fig. 7.

Loss of CPL3 function increases polyploidy levels.(A) Relative ratios of each cell ploidy of 8- and 16-day-old first leaves of Col-0, cpl3, 35S::CPL3 and CPL3p::CPL3 Arabidopsisplants. (B) Relative ratios of each cell ploidy of 3-week-old third leaves of Col-0, cpl3, 35S::CPL3 and CPL3p::CPL3.Approximately 5000 nuclei were counted in Col-0, cpl3, 35S::CPL3 and CPL3p::CPL3 tissues.

When CaMV 35S is used as a promoter for the expression of CPL3,the number of root hairs is increased, and no trichomes are formed in transformant lines, as observed in 35S::CPC, 35S::TRY, 35S::ETC1 and 35S::ETC2 transformants (Fig. 2, Tables 2, 3)(Wada et al., 1997; Schellmann et al., 2002; Kirik et al., 2004a; Kirik et al., 2004b). Yeast two-hybrid analyses showed that CPC, TRY, ETC1, ETC2 and CPL3 are capable of interacting with GL3, EGL3 and AtMYC1 (see Fig. S6 in the supplementary material). These findings demonstrate that CPL3 and the other CPC-like MYB proteins have a similar binding function. Although EGL3 had higher promoter activity and RNA accumulation than GL3, the mutant phenotype of egl3 was `weaker' than that of gl3(Bernhardt et al., 2003; Bernhardt et al., 2005). The strong trichome deficiency and proliferation of root hair phenotypes of the gl3 mutant are probably due to the strong binding activity of GL3 with the CPC-like MYB proteins.

CPL3p::GUS was mainly expressed around stomata(Fig. 4F-H), but the cpl3 mutant, cpl3 etc2 double mutant and CPL3overexpressors did not have aberrant stomatal phenotypes(Table 5, and see Tables S1,S2, S3 in the supplementary material). We counted stomates on cotyledons,which do not differ much in size regardless of their genotype. Therefore,stomatal density is apparently relatively constant(Table 5). The stomatal phenotypes of true leaves were also observed several times. Thus, we concluded that CPL3 did not affect stomate formation in leaves, although the gene is expressed there. The expression patterns of CPC homologs have been roughly classified into two groups. CPCp::GUS, TRYp::GUS and ETC1p::GUS are expressed mainly in roots and trichomes, and ETC2p::GUS and CPL3p::GUS are expressed in young leaves and guard cells (see Fig. S7 in the supplementary material). Thus, GUS expression by the CPC-like MYB family is found in tissues throughout the entire plant body. CPL3p::GUS expression was reduced in the cpc and etc1 backgrounds (see Fig. S8 in the supplementary material). These results suggest that the members of this regulatory protein family play different roles. Given the complexity of regulatory cascades and the contributions of phytohormones, cell-wall-associated proteins and cytoskeleton structures, it is nonetheless likely that this gene family has fairly direct control over epidermal differentiation, development and integration for the entire plant.

Intriguing features of the CPL3 gene

Although the general effect of CPL3 on cell fate is similar to that of CPC, TRY, ETC1 and ETC2, CPL3 has several characteristics that make it distinct from the other CPC homologs. First, the cpl3-1 mutant itself has a reduced number of root hairs,whereas etc1-1 and etc2-2 have normal root hair numbers(Fig. 2B, and see Fig. S1A in the supplementary material). cpl3-1 also produces an increased number of trichomes, similar to cpc-2(Fig. 2N, and see Fig. S1B in the supplementary material). Secondly, most stomata are distributed in the S position in wild-type hypocotyls, but transformant line 35S::CPL3trichomes are evenly distributed in both the S and N positions(Table 6, and see Table S4, S5 in the supplementary material). Thirdly, cpl3 plants have an early flowering phenotype (Table 7,and see Table S6 in the supplementary material). Expression of the FTand SOC1 genes in the cpl3 mutant was increased compared with wild type (Fig. 5A,B). A flowering regulatory cascade model would thus include repression of FT and SOC1 by CPL3. CPL3 expression is significantly higher in 35S::CPL3 and CPL3p::CPL3transformant lines than in wild type during leaf development(Fig. 5D). If CPL3 directly represses FT and SOC1, their expression in 35S::CPL3 and CPL3p::CPL3 plants would be reduced significantly (Fig. 5A,B). One possibility is that CO or some other factor overcomes the function of CPL3 to repress FT and SOC1. Fourthly, cpl3 plants have an abnormally large growth phenotype, and CPL3 overexpressers have a dwarf phenotype (Fig. 6). The hypertrophic cell phenotype of cpl3 is associated with an increase in endoreduplication (Fig. 7). CPL3 is thus likely to play an essential role in ploidy-dependent epidermal cell growth in Arabidopsis. Endoreduplication is generally thought to provide a mechanism for increasing cell size(Sugimoto-Shirasu and Roberts,2003), although the correlation between ploidy level and cell size is not always high (Leiva-Neto et al.,2004; Gendreau et al.,1998; Schnittger et al.,2003).

Fig. 8.

CYCA and SIM expression in cpl3 mutant and transgenic Arabidopsis plants expressing CPL3. Real-time PCR analysis of CYCA2;1 (A), CYCA2;2 (B), CYCA2;3 (C), CYCA2;4 (D), CYCA1;1(E) and SIM (F) in wild type, cpl3, 35S::CPL3and CPL3p::CPL3 at four developmental stages. Expression levels of each gene were normalized to ACT2 expression. Relative expression levels: expression levels of each gene relative to wild type at 12 days. The experiment was repeated four times. Error bars indicate s.d. Student's t-test, *P<0.020 versus wild type.

Fig. 8.

CYCA and SIM expression in cpl3 mutant and transgenic Arabidopsis plants expressing CPL3. Real-time PCR analysis of CYCA2;1 (A), CYCA2;2 (B), CYCA2;3 (C), CYCA2;4 (D), CYCA1;1(E) and SIM (F) in wild type, cpl3, 35S::CPL3and CPL3p::CPL3 at four developmental stages. Expression levels of each gene were normalized to ACT2 expression. Relative expression levels: expression levels of each gene relative to wild type at 12 days. The experiment was repeated four times. Error bars indicate s.d. Student's t-test, *P<0.020 versus wild type.

Previous studies have shown that a mutation in TRY leads to increased endoreduplication in trichomes and reduced endoreduplication in the epidermis (Szymanski and Marks,1998). This is the opposite of what happens in the cpl3mutant. Because a mutation in CPL3 leads to an increase in endoreduplication in the epidermis (Fig. 7), a decrease in trichome branching might be the result of reduced endoreduplication in trichomes(Fig. 3F, Table 4). It has been postulated that TRY is expressed in trichomes, reducing endoreduplication in those cells, followed by diffusion into neighboring cells to mediate lateral inhibition (Schellmann et al., 2002). Thus, we propose a model in which CPL3 is expressed in young leaf epidermal cells and represses endoreduplication, after which it affects neighboring trichome cells by slightly promoting endoreduplication.

A2-type cyclins play an important role in regulating endoreduplication in Arabidopsis (Burssens et al.,2000; Imai et al.,2006; Yoshizumi et al.,2006). CYCA2;1 is expressed in various differentiated cells, such as guard cells (Burssens et al., 2000), and loss of CYCA2;3 increases polyploidy in mature true leaves (Imai et al.,2006). However, we could not detect any significant change in the expression of CYCA genes in cpl3 mutant and transgenic Arabidopsis plants expressing CPL3. SIM is a cell cycle regulator that controls endoreduplication onset in Arabidopsis(Churchman et al., 2006). SIM transcript levels are increased in GL3-overexpressing lines and decreased in the gl3 egl3 double mutant(Churchman et al., 2006). Because CPL3 can bind to GL3 and EGL3 (see Fig. S6 in the supplementary material), it might inhibit GL3 and/or EGL3 function to induce expression of SIM (Fig. 8F).

The CPC-like MYB gene families are thought to have evolved by gene duplication (Fig. 1C). Gene family members that have not completely diverged functionally and thus retain some functional redundancy may represent intermediate stages of regulatory specification (Thomas, 1993; Cooke et al., 1997). As such,they can provide considerable potential for adaptive or evolutionary responses to environmental changes or occupation of a new ecological niche through selection for the most advantageous cell size and flowering time.

We thank Dr Yoshizumi for technical advice, M. Sato, K. Toyooka, M. Wakazaki, Y. Miyazaki, H. Oka and T. Gohara for technical assistance, and T. Araki, S. Yamaguch, Y. Kamiya, T. Ishida and T. Kurata for useful suggestions. This work was supported in part by Grants-in-Aid from the Ministry of Education, Science, Sports and Culture of Japan (15770152).

Bagnall, D. J. (
1993
). Light quality and vernalization interact in controlling late flowering in Arabidopsis ecotypes and mutants.
Ann. Bot
.
71
,
75
.
Berger, F., Linstead, P., Dolan, L. and Haseloff, J.(
1998
). Stomata patterning on the hypocotyl of Arabidopsis thaliana is controlled by genes involved in the control of root epidermis patterning.
Dev. Biol.
194
,
226
-234.
Bernhardt, C., Lee, M. M., Gonzalez, A., Zhang, F., Lloyd, A. and Schiefelbein, J. (
2003
). The bHLH genes GLABRA3 (GL3) and ENHANCER OF GLABRA3 (EGL3) specify epidermal cell fate in the Arabidopsis root.
Development
130
,
6431
-6439.
Bernhardt, C., Zhao, M., Gonzalez, A., Lloyd, A. and Schiefelbein, J. (
2005
). The bHLH genes GL3 and EGL3 participate in an intercellular regulatory circuit that controls cell patterning in the Arabidopsis root epidermis.
Development
132
,
291
-298.
Burssens, S., de Almeida Engler, J., Beeckman, T., Richard, C.,Shaul, O., Ferreira, P., Van Montagu, M. and Inze, D. (
2000
). Developmental expression of the Arabidopsis thaliana CycA2;1 gene.
Planta
211
,
623
-631.
Churchman, M. L., Brown, M. L., Kato, N., Kirik, V., Hulskamp,M., Inze, D., De Veylder, L., Walker, J. D., Zheng, Z., Oppenheimer, D. G. et al. (
2006
). SIAMESE, a plant-specific cell cycle regulator,controls endoreplication onset in Arabidopsis thaliana.
Plant Cell
18
,
3145
-3157.
Clough, S. J. and Bent, A. F. (
1998
). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana.
Plant J.
16
,
735
-743.
Cooke, J., Nowak, M. A., Boerlijst, M. and Maynard-Smith, J.(
1997
). Evolutionary origins and maintenance of redundant gene expression during metazoan development.
Trends Genet.
13
,
360
-364.
Czechowski, T., Bari, R. P., Stitt, M., Scheible, W. R. and Udvardi, M. K. (
2004
). Real-time RT-PCR profiling of over 1400 Arabidopsis transcription factors: unprecedented sensitivity reveals novel root- and shoot-specific genes.
Plant J.
38
,
366
-379.
Di Cristina, M., Sessa, G., Dolan, L., Linstead, P., Baima, S.,Ruberti, I. and Morelli, G. (
1996
). The Arabidopsis Athb-10(GLABRA2) is an HD-Zip protein required for regulation of root hair development.
Plant J.
10
,
393
-402.
Dolan, L., Janmaat, K., Willemsen, V., Linstead, P., Poethig,S., Roberts, K. and Scheres, B. (
1993
). Cellular organisation of the Arabidopsis thaliana root.
Development
119
,
71
-84.
Esch, J. J., Chen, M., Sanders, M., Hillestad, M., Ndkium, S.,Idelkope, B., Neizer, J. and Marks, M. D. (
2003
). A contradictory GLABRA3 allele helps define gene interactions controlling trichome development in Arabidopsis.
Development
130
,
5885
-5894.
Esch, J. J., Chen, M. A., Hillestad, M. and Marks, M. D.(
2004
). Comparison of TRY and the closely related At1g01380 gene in controlling Arabidopsis trichome patterning.
Plant J.
40
,
860
-869.
Folkers, U., Berger, J. and Hulskamp, M.(
1997
). Cell morphogenesis of trichomes in Arabidopsis:differential control of primary and secondary branching by branch initiation regulators and cell growth.
Development
124
,
3779
-3786.
Gendreau, E., Hofte, H., Grandjean, O., Brown, S. and Traas,J. (
1998
). Phytochrome controls the number of endoreduplication cycles in the Arabidopsis thaliana hypocotyl.
Plant J.
13
,
221
-230.
Heim, M. A., Jakoby, M., Werber, M., Martin, C., Weisshaar, B. and Bailey, P. C. (
2003
). The basic helix-loop-helix transcription factor family in plants: a genome-wide study of protein structure and functional diversity.
Mol. Biol. Evol.
20
,
735
-747.
Huang, T., Bohlenius, H., Eriksson, S., Parcy, F. and Nilsson,O. (
2005
). The mRNA of the Arabidopsis gene FT moves from leaf to shoot apex and induces flowering.
Science
309
,
1694
-1696.
Hulskamp, M., Misra, S. and Jurgens, G. (
1994
). Genetic dissection of trichome cell development in Arabidopsis.
Cell
76
,
555
-566.
Hung, C. Y., Lin, Y., Zhang, M., Pollock, S., Marks, M. D. and Schiefelbein, J. (
1998
). A common position-dependent mechanism controls cell-type patterning and GLABRA2 regulation in the root and hypocotyl epidermis of Arabidopsis.
Plant Physiol.
117
,
73
-84.
Imai, K. K., Ohashi, Y., Tsuge, T., Yoshizumi, T., Matsui, M.,Oka, A. and Aoyama, T. (
2006
). The A-type cyclin CYCA2;3 is a key regulator of ploidy levels in Arabidopsis endoreduplication.
Plant Cell
18
,
382
-396.
Jarvis, P., Chen, L. J., Li, H., Peto, C. A., Fankhauser, C. and Chory, J. (
1998
). An Arabidopsis mutant defective in the plastid general protein import apparatus.
Science
282
,
100
-103.
Kallal, L. and Kurjan, J. (
1997
). Analysis of the receptor binding domain of Gpa1p, the G(alpha) subunit involved in the yeast pheromone response pathway.
Mol. Cell. Biol.
17
,
2897
-2907.
Kirik, V., Simon, M., Wester, K., Schiefelbein, J. and Hulskamp,M. (
2004a
). The ENHANCER OF TRY AND CPC1 gene acts redundantly with TRIPTYCHON and CAPRICE in trichome and root hair cell patterning in Arabidopsis.
Dev. Biol.
268
,
506
-513.
Kirik, V., Simon, M., Huelskamp, M. and Schiefelbein, J.(
2004b
). ENHANCER of TRY and CPC 2 (ETC2) reveals redundancy in the region-specific control of trichome development of Arabidopsis.
Plant Mol. Biol.
55
,
389
-398.
Koornneef, M., Hanhart, C. J. and van der Veen, J. H.(
1991
). A genetic and physiological analysis of late flowering mutants in Arabidopsis thaliana.
Mol. Gen. Genet.
229
,
57
-66.
Kurata, T., Kawabata-Awai, C., Sakuradani, E., Shimizu, S.,Okada, K. and Wada, T. (
2003
). The YORE-YORE gene regulates multiple aspects of epidermal cell differentiation in Arabidopsis.
Plant J.
36
,
55
-66.
Kurata, T., Ishida, T., Kawabata-Awai, C., Noguchi, M., Hattori,S., Sano, R., Nagasaka, R., Tominaga, R., Koshino-Kimura, Y., Kato, T. et al. (
2005
). Cell-to-cell movement of the CAPRICE protein in Arabidopsis root epidermal cell differentiation.
Development
132
,
5387
-5398.
Larkin, J. C., Oppenheimer, D. G., Lloyd, A. M., Paparozzi, E. T. and Marks, M. D. (
1994
). Roles of the GLABROUS1 and TRANSPARENT TESTA GLABRA Genes in Arabidopsis Trichome Development.
Plant Cell
6
,
1065
-1076.
Lee, H., Suh, S. S., Park, E., Cho, E., Ahn, J. H., Kim, S. G.,Lee, J. S., Kwon, Y. M. and Lee, I. (
2000
). The AGAMOUS-LIKE 20 MADS domain protein integrates floral inductive pathways in Arabidopsis.
Genes Dev
.
14
,
2366
-2376.
Lee, M. M. and Schiefelbein, J. (
1999
). WEREWOLF, a MYB-related protein in Arabidopsis, is a position-dependent regulator of epidermal cell patterning.
Cell
99
,
473
-483.
Leiva-Neto, J. T., Grafi, G., Sabelli, P. A., Dante, R. A., Woo,Y. M., Maddock, S., Gordon-Kamm, W. J. and Larkins, B. A.(
2004
). A dominant negative mutant of cyclin-dependent kinase A reduces endoreduplication but not cell size or gene expression in maize endosperm.
Plant Cell
16
,
1854
-1869.
Masucci, J. D., Rerie, W. G., Foreman, D. R., Zhang, M., Galway,M. E., Marks, M. D. and Schiefelbein, J. W. (
1996
). The homeobox gene GLABRA2 is required for position-dependent cell differentiation in the root epidermis of Arabidopsis thaliana.
Development
122
,
1253
-1260.
Nesi, N., Debeaujon, I., Jond, C., Pelletier, G., Caboche, M. and Lepiniec, L. (
2000
). The TT8 gene encodes a basic helix-loop-helix domain protein required for expression of DFR and BAN genes in Arabidopsis siliques.
Plant Cell
12
,
1863
-1878.
Okada, K. and Shimura, Y. (
1990
). Reversible root tip rotation in Arabidopsis seedlings induced by obstacle-touching stimulus.
Science
250
,
274
-276.
Rerie, W. G., Feldmann, K. A. and Marks, M. D.(
1994
). The GLABRA2 gene encodes a homeo domain protein required for normal trichome development in Arabidopsis.
Genes Dev.
8
,
1388
-1399.
Rosinski, J. A. and Atchley, W. R. (
1998
). Molecular evolution of the Myb family of transcription factors: evidence for polyphyletic origin.
J. Mol. Evol.
46
,
74
-83.
Schellmann, S., Schnittger, A., Kirik, V., Wada, T., Okada, K.,Beermann, A., Thumfahrt, J., Jurgens, G. and Hulskamp, M.(
2002
). TRIPTYCHON and CAPRICE mediate lateral inhibition during trichome and root hair patterning in Arabidopsis.
EMBO J
.
21
,
5036
-5046.
Schnittger, A., Weinl, C., Bouyer, D., Schobinger, U. and Hulskamp, M. (
2003
). Misexpression of the cyclin-dependent kinase inhibitor ICK1/KRP1 in single-celled Arabidopsis trichomes reduces endoreduplication and cell size and induces cell death.
Plant Cell
15
,
303
-315.
Simon, M., Lee, M. M., Lin, Y., Gish, L. and Schiefelbein,J. (
2007
). Distinct and overlapping roles of single-repeat MYB genes in root epidermal patterning.
Dev. Biol
.
311
,
566
-578.
Sugimoto-Shirasu, K. and Roberts, K. (
2003
).“Big it up”: endoreduplication and cell-size control in plants.
Curr. Opin. Plant Biol.
6
,
544
-553.
Szymanski, D. B. and Marks, M. D. (
1998
). GLABROUS1 overexpression and TRIPTYCHON alter the cell cycle and trichome cell fate in Arabidopsis.
Plant Cell
10
,
2047
-2062.
Thomas, J. H. (
1993
). Thinking about genetic redundancy.
Trends Genet.
9
,
395
-399.
Urao, T., Yamaguchi-Shinozaki, K., Mitsukawa, N., Shibata, D. and Shinozaki, K. (
1996
). Molecular cloning and characterization of a gene that encodes a MYC-related protein in Arabidopsis.
Plant Mol. Biol.
32
,
571
-576.
Wada, T., Tachibana, T., Shimura, Y. and Okada, K.(
1997
). Epidermal cell differentiation in Arabidopsis determined by a Myb homolog, CPC.
Science
277
,
1113
-1116.
Wada, T., Kurata, T., Tominaga, R., Koshino-Kimura, Y.,Tachibana, T., Goto, K., Marks, M. D., Shimura, Y. and Okada, K.(
2002
). Role of a positive regulator of root hair development,CAPRICE, in Arabidopsis root epidermal cell differentiation.
Development
129
,
5409
-5419.
Yadegari, R., Paiva, G., Laux, T., Koltunow, A. M., Apuya, N.,Zimmerman, J. L., Fischer, R. L., Harada, J. J. and Goldberg, R. B.(
1994
). Cell differentiation and morphogenesis are uncoupled in Arabidopsis raspberry embryos.
Plant Cell
6
,
1713
-1729.
Yoo, S. Y., Bomblies, K., Yoo, S. K., Yang, J. W., Choi, M. S.,Lee, J. S., Weigel, D. and Ahn, J. H. (
2005
). The 35S promoter used in a selectable marker gene of a plant transformation vector affects the expression of the transgene.
Planta
221
,
523
-530.
Yoshizumi, T., Tsumoto, Y., Takiguchi, T., Nagata, N., Yamamoto,Y. Y., Kawashima, M., Ichikawa, T., Nakazawa, M., Yamamoto, N. and Matsui,M. (
2006
). Increased level of polyploidy1, a conserved repressor of CYCLINA2 transcription, controls endoreduplication in Arabidopsis.
Plant Cell
18
,
2452
-2468.

Supplementary information