David Stafford, Richard J. White, Mary D. Kinkel, Angela Linville,Thomas F. Schilling and Victoria E. Prince
There was an error published in Development133, 949-956.
There was a mistake in the sequence of the raldh2 morpholino, which was missing three nucleotides. The correct sequence is as follows: 5′GCAGTTCAACTTCACTGGAGGTCAT
The authors apologise to readers for this mistake.
© 2006.
2006