Coordinate expression of the three zona pellucida genes during mouse oogenesis

The zona pellucida surrounds growing oocytes, ovulated eggs and preimplantation embryos in mammals. It plays a critical role in the species-specificity of fertilization, the postfertilization block to polyspermy and protects the early embryo as it passes down the oviduct (Yanagimachi, 1994). While primordial oocytes do not have a zona pellucida, the zona glycoproteins represent a major secretory product of growing oocytes. The zona matrix first appears as amorphous material deposited in the space between the oocyte and the surrounding granulosa cells. This material is subsequently assembled into long filaments forming a highly porous matrix that increases in thickness to 7 μm in fully grown mouse oocytes (Phillips and Shalgi, 1980).

The mouse zona is composed of three sulfated glycoproteins designated ZP1, ZP2 and ZP3 (Bleil and Wassarman, 1980b; Shimizu et al., 1983). The primary structures of ZP2 and ZP3 have been deduced from full-length cDNAs that encode polypeptides of 80,217 and 46,307 M_r, respectively (Ringuette et al., 1988; Liang et al., 1990). However, due to post-translational modifications, including glycosylation, the sizes of the secreted, native ZP2 and ZP3 proteins are heterogeneous with average M_r of 120-140 and 83×10³, respectively. No primary structural information is available for ZP1 and little is known about the protein. After staining or metabolic labeling, it appears as the least abundant of the three mouse zona glycoproteins on SDS-PAGE, where it has an apparent M_r of 185-200×10³. Under reducing conditions, ZP1 co-migrates with ZP2 at 120×10³M_r suggesting that it is present in the zona as a disulfide-bond-linked dimer (Bleil and Wassarman, 1980b; Shimizu et al., 1983).

A current model proposes specific biological functions for each mouse zona protein (Greve and Wassarman, 1985). Considerable in vitro data suggest that mouse sperm initially bind to O-linked oligosaccharides attached to ZP3 (Florman and Wassarman, 1985; Kinloch et al., 1995), although the identification of the corresponding sperm receptor remains controversial (Youakim et al., 1994; Leyton et al., 1992; Cheng et al., 1994). The primary interaction with ZP3 triggers the sperm acrosome reaction (Saling, 1991), releasing lytic enzymes (considered important for sperm penetration of the zona matrix) and exposing additional macromolecules, which appear to be involved in secondary binding of sperm to ZP2 (Bleil et al., 1988). ZP1 has been proposed as a crosslinker of filaments composed of ZP2/ZP3 dimers. Selective proteolytic degradation of ZP1 or reduction of disulfide bonds results in disruption of interconnections between zona filaments in the mouse (Greve and Wassarman, 1985). Thus, ZP1 appears to provide structural integrity to the mouse zona matrix to maintain its biologic activity.

Additional observations suggest that the role of ZP1 may not be the same in all species. Zonae pellucidae have been biochemically characterized in other mammals, including rabbit (Dunbar et al., 1981), pig (Hedrick and Wardrip, 1987) and human (Shabanowitz and O’Rand, 1988). Although all zonae are composed of three glycoproteins, variations in nomenclature have confused the correspondence of particular zona proteins among mammals. The recent cloning of zona genes in different species has improved our understanding of the structural homology of zona proteins among mammals. However, there remain discrepant data on the biologic function of particular zona proteins. For example, although no in vitro sperm binding activity was detected with mouse ZP1 (Bleil and Wassarman, 1980a), the porcine homologue to mouse ZP1 has been reported to have sperm-binding activity (Sacco et al., 1989; Yurewicz et al., 1991). Whether these observations represent biological differences among mammals or differences in experimental design remains to be determined.

Zona gene expression provides a potential paradigm for studying mechanisms of oocyte-specific gene expression and a marker of oocyte growth and differentiation. Previously, we reported the characterization of mouse Zp2 and Zp3 genes (Liang and Dean, 1993; Chamberlin and Dean, 1990) and showed that both transcripts were detected only in oocytes (Liang et al., 1990; Ringuette et al., 1988). In additional experiments, in situ hybridization of ovarian sections with a ZP3 antisense probe confirmed the presence of zona transcripts in oocytes and did not detect transcripts in granulosa cells (Philpott et al., 1987). These data led to the hypothesis that the zona genes are expressed in an oocyte-specific manner. While there is general agreement that the zona genes are expressed in oocytes, others have reported that zona genes are also expressed in granulosa cells, where their protein products can be detected (Wolgemuth et al., 1984; Lee and Dunbar, 1993). These later studies were conducted in the rabbit, using rc55, a cDNA that encodes a zona protein distinct from mouse ZP2 or ZP3, raising the possibility that it is the homologue of mouse ZP1.

Having a complete set of the mouse zona cDNAs would make possible the simultaneous determination of the expression of the three mouse genes. Additionally, these reagents would be of particular value in further establishing the role of each zona protein in forming the zona matrix and in defining domains important for specific biological functions. We now report the isolation of a mouse ZP1 cDNA clone and establish that it is a homologue of rabbit rc55. Using a sensitive RNase protection assay and in situ hybridization, we examine the abundance of the three zona transcripts during oocyte growth and demonstrate that the expression of these genes is coordinate and oocyte-specific.

Zonae pellucidae were isolated from 3000, 3-week-old mouse ovaries (NIH Swiss) after homogenization and centrifugation through a Percoll gradient (Bleil et al., 1988). Following solubilization (60°C, 1 hour in 200 μl 50 mM Tris, pH 8), the zona proteins were separated by preparative non-reducing SDS-PAGE (7%). Gel purified ZP1 (approximately 50 μg) was used to immunize a 6-week-old male rat (Sprague Dawley) by intraperitoneal injection of a 1:1 suspension of acrylamide:Freund’s complete adjuvant (Difco) containing 20 μg of mouse ZP1 protein followed by 2 further injections (15 μg in Freund’s incomplete adjuvant) at 20-day intervals. The specificity of the resultant antisera was confirmed by probing a western blot (Burnette, 1981) of mouse zona pellucida proteins separated by SDS-PAGE.

ZP1 protein from 500 mice was purified by SDS-PAGE (Moos et al., 1988) using a 6% Long Ranger (AT Biochem) gel and 4 M urea in the sample buffer. After transfer to Immobilon-P PVDF membrane (Matsudaira, 1987), the N-terminal sequence of ZP1 was determined on an Applied Biosystems Sequencer (Model 477A with 120A PTH amino acid analyzer).

To obtain internal sequence, zona proteins were separated by SDS-PAGE, stained with 0.01% 3, 3′-dipentyloxacarbocyanine iodide (Molecular Probes) in 2% MeOH, 0.2% SDS, 50 mM NaHCO3 (20°C, 20 minutes) and destained in water (M. Moos, details to be published elsewhere). The ZP1 band was excised (302 nm transillumination), washed (2× 1 ml H₂O, 15 minutes) and dried in vacuo to 20% of its original volume. After rehydration (1 ml, 50 mM Tris-HCl pH 8.3, 2 mM CaCl₂, 4 M urea), ZP1 was incubated (20°C, 16 hours) with 1 g of sequencing grade modified trypsin (Promega).

Tryptic peptides were extracted sequentially with 0.5 ml 4 M urea, 1 ml 1% trifluoroacetic acid (TFA), and 1 ml 0.1% TFA, 80% acetonitrile for 1 hour each with vigorous agitation at 20°C. The extracts were combined, filtered (0.22 μm) and injected onto a 2.1×250 mm Vydac 214TP52 C4 column equilibrated at 60°C with 0.1% TFA, 5% acetonitrile (Solvent A) at a flow rate of 150 L/minutes in a Hewlett-Packard model 1090 chromatograph. After a 15 minute isocratic hold, peptides were eluted by increasing the concentration of Solvent B (0.085% TFA in 80% acetonitrile) to 35% over 60 minutes, from 35% to 75% over 30 minutes, and from 75% to 100% over 15 minutes (Stone and Williams, 1986). Peptides detected by absorption at 215 nm were collected by hand and analyzed as above with modification (Tempst and Riviere, 1989) using Applied Biosystems Model 610A software (Matsudaira, 1987).

5 μg of ovarian poly(A)⁺ RNA from 250 10-day-old mice were isolated on an Oligotex-dT column (Qiagen) and used to create an oligo(dT)-primed, directionally-cloned cDNA expression library in lambda ZAP (Stratagene). The library was packaged with Gigapack II Gold extract (Stratagene); a single reaction (50 ng of cDNA) resulted in 1-2×10⁶ pfu. Using T3 and T7 oligonucleotides in a PCR analysis of 34 clones, the library was estimated to be 97% recombinant with an average insert size of 1.2 kb.

1×10⁶ pfu of the primary library were screened with rat anti-mouse ZP1 antiserum (1:400) as described (Sambrook et al., 1989), except the blocking solution was 1% BSA and the washes were 20 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.05% Tween-20. Filter-bound primary antibodies were detected with alkaline-phosphatase-conjugated, goat anti-rat antibodies (BIO-RAD) and a BCIP/NBT color development solution (Sigma) per the manufacturer’s instructions. Immunopositive clones were plaque-purified, and plasmids were excision rescued following the manufacturer’s instructions (Stratagene).

After heating (99°C, 5 minutes), 1×10⁷ pfu of the amplified library were used in PCR with a vector-specific, oligo-primer 5′ AACAGC-TATGACCATGATTACGCC 3′ and a ZP1-specific oligo-primer (396-419 nt, Fig. 1), 5′ TGTGCTATATCCACACGGCCATTG 3′, in a Perkin Elmer GeneAmp PCR System 9600. The following conditions were used: 95°C for 2 minutes; 35 cycles of 95°C for 15 seconds, 65°C for 45 seconds, 72°C for 1 minute; 72°C for 7 minutes. The PCR products were gel purified and subcloned into the TA cloning vector (Invitrogen).

The sequence of the cDNA inserts was determined by a DMSO-modified dideoxy chain termination method (Seto, 1990) using [α-³⁵S]dATP (Amersham), the Sequenase Sequencing Kit (US Bio-chemicals, Ver. 2) and separation on gels (6%) made from Sequagel-6 acrylamide solution (National Diagnostics). Both strands were sequenced using T3 and T7 primers as well as specific internal oligonucleotide primers. Sequence comparison and translation were performed using the Genetic Computer Group (1991) and PCGene (IntelliGentics) computer software, respectively. The accession number of the cDNA sequence in GenBank is U20448.

Internal organs were dissected from 10-day-old mice, and total RNA was isolated by the RNAzol B method (Tel-Tec, Inc.). Poly(A)⁺ RNA was purified using Oligotex-dt columns (Qiagen), electrophoresed in a 1% agarose/formaldehyde gel and transferred to a Nytran nylon membrane (Schleicher & Schuell) (Derman et al., 1981). A ZP1 cDNA fragment (150-1963 bp) was ³²P-labelled by random-priming (Boehringer Mannheim) according to the manufacturer’s instructions and used to probe the northern blot in aqueous hybridization solution (6 × SSC) at 65°C. Final washes were at 65°C with 0.1×SSC, 0.1% SDS (Sambrook et al., 1989). The filter was stripped by boiling and rehybridized with a hamster actin probe (Ringuette et al., 1986).

Ovaries from 13-day old neonates were fixed in 4% paraformaldehyde in PBS (1 hour, room temperature), rinsed in PBS and dehydrated. Tissues were embedded in paraffin and 4 μm sections were placed on silanated slides (Manova et al., 1990). cDNA fragments of ZP1 (1647 bp), ZP2 (1723 bp) and ZP3 (944 bp) were subcloned into Bluescript (Stratagene). Sense and antisense labelled transcripts were generated using a MAXIscript T7/T3 kit (Ambion) according to the manufacturer’s specifications. Reactions (20 μl) were optimized (22°C, 2 hours) for full-length transcripts using 80 pmoles of [α-³³P]UTP (Amersham) and 1 μg of the appropriate linearized template. The probes were purified on G-50 Sephadex mini-columns (5 PRIME→3 PRIME).

Shorter probe fragments (200-400 bp) were derived by alkaline hydrolysis (1/10 volume 1M sodium carbonate, pH 10.2 at 65°C, 10 minutes). The RNA fragments were precipitated and resuspended in hybridization buffer at a concentration of 5×10⁴ cps/minute/μl. In situ hybridization was performed as described (Manova et al., 1990) except that the slides were prehybridized and hybridized at 60°C overnight using 50% formamide and 0.4 M NaCl. After dipping in Kodak NTB-2 emulsion, the slides were exposed for 4 (ZP2 and ZP3) or 7 (ZP1) days. They were then developed in Kodak Developer D-19 and Kodak Fixer and stained in hematoxylin (Fisher) and eosin (Polyscience, Inc.) according to standard procedures. Multiple slides of each of two hybridizations were examined.

15 μm (resting), 40 μm, 50 μm, 60 μm and 80 μm diameter oocytes were isolated from the ovaries of 3-, 8-, 10-, 14-day-old and 3-week-old female NIH Swiss mice, respectively (Huarte et al., 1987). Ovulated eggs (metaphase II) were isolated from the ampullae of 5-week-old, superovulated mice 16 hours after hCG injection and freed of cumulus cells by 300 μg/ml hyaluronidase digestion (Sigma) (Hogan et al., 1986). Oocytes were isolated in incomplete Brinster medium (Ca²⁺/Mg²⁺-free) containing 0.4 mM sodium pyruvate and then transferred into complete Brinster medium with 3 mg/ml bovine serum albumin and 0.4 mM sodium pyruvate (Sigma) (Hogan et al., 1986). Oocytes were size-selected by micrometer lens, and groups of 50 were solubilized in 10 μl 5 M guanidine thiocyanate.

Fragments derived from ZP1 (95-611 nt), ZP2 (22-486 nt) and ZP3 (1-233 nt) cDNAs were subcloned into Bluescript-KS. After linearization at the 3′-end, sense-strand RNAs were transcribed in the presence of excess cold NTPs and trace amount of [5-³H]CTP (NEN). The synthetic mRNAs were quantified by incorporation measurement and diluted for use in standard curves. ZP1 (95-611 nt), ZP2 (34-481 nt) and ZP3 (28-233 nt) cDNA fragments subcloned in Bluescript-KS were linearized at the 5′-end and antisense probes were prepared by incorporation of [α³²-P]UTP (Amersham) into the transcripts, using the MAXIscript kit (Ambion). Unincorporated nucleotides were removed by G-50 Sephadex minicolumns (5 PRIME→3 PRIME).

The RNase protection assay was performed using the RPA II kit (Ambion) protocol, except the mixture containing the probes was added directly to the sample lysate in 5 M guanidinium thiocyanate (Haines and Gillespie, 1992). Standard curves for each zona transcript were constructed using known amounts (0.8-120 attomole) of synthetic sense-strand RNAs. Yeast RNA, oocyte lysates or standards containing increasing amounts of the three synthetic RNAs were simultaneously hybridized with 1.2 fmole of ZP1 (562 nt), ZP2 (406 nt) and ZP3 (259 nt) ³²P-labelled antisense probes. The protected fragments were separated on a 4% acrylamide-8 M urea gel and detected by autoradiography. End-labelled DNA fragments of pUC19 digested with Sau3AI were used as molecular weight markers and do not correspond exactly to the size of the RNA probes. The intensity of each zona band was determined by PhosphorImager (Molecular Dynamics) using ImageQuant software. Results represent the average of three independent experiments (± s.e.m.), each conducted with a standard curve.

Despite extensive screening of previously reported mouse ovarian cDNA expression libraries with immunologic probes reactive with ZP1, no clones encoding mouse ZP1 were identified. Therefore, a primary cDNA library was constructed using poly(A)⁺ RNA from 10-day-old mouse ovaries and screened with antisera specific to gel-purified ZP1. Seven immunoreactive clones with inserts ranging from 1.5 to 1.9 kbp were plaque purified and their inserts isolated as plasmids. Five had sequences with open reading frames containing amino acid sequence that exactly matched that of an internal peptide obtained from native ZP1. The longest of these clones (150-1963 nt, Fig. 1) was missing the 5′ end of the ZP1 cDNA. Therefore, 1×10⁷ pfu of the amplified cDNA library were used as a substrate in a PCR using synthetic oligonucleotide primers specific to ZP1 (396-419 nt, Fig. 1) and to the 5′ phage multicloning site. Each of two separate PCR reactions resulted in 384 bp products containing the identical DNA sequence (36-419 nt, Fig. 1). Taking advantage of a unique restriction site (Sph I) present in the overlap of the 5′ PCR fragment and the 3′ fragment obtained from screening the library, a single near full-length clone (MoZP1.2) was constructed and used in subsequent analysis. The remaining 5′ sequence (35 nt) of the untranslated region was obtained from a genomic clone after the transcription start was determined by an RNase protection assay (data to be published elsewhere).

The 1963 nt full-length mouse ZP1 mRNA (Fig. 1) has a single open reading frame of 1869 nt flanked by relatively short 5′ and 3′ untranslated regions of 57 and 37 nt, respectively. Similar short untranslated regions are characteristic of the two other mouse zona transcripts (Ringuette et al., 1988; Liang et al., 1990). The AUG initiation codon lies within the context of the ANNAUG motif associated with vertebrate initiator codons (Kozak, 1991), and an AAUAAA polyadenylation signal is located just 9 nt downstream of the termination codon. The open reading frame encodes a protein of 623 amino acids with a calculated relative molecular mass of 69,679 (8.7% acidic, 10.6% basic, 9.6% aromatic, 45.9% hydrophobic residues). The identity of the ZP1 clone was confirmed by matches between the predicted amino acid sequence deduced from the cDNA with that determined by microsequencing an N-terminal and three internal tryptic peptides derived from native mouse ZP1 (Fig. 1).

A 20 amino acid N-terminal signal peptide is predicted from the deduced amino acid sequence (Von Heijne, 1985, 1986) and the signal peptidase cleavage site at amino acid position 21 was confirmed by N-terminal sequencing of ZP1 (Figs 1,2). Like other zona proteins, ZP1 has a carboxyl terminal transmembrane domain (amino acids 590-615) that may be important for its intracellular trafficking and/or assembly into the zona matrix (Fig. 2). 41 residues upstream of this hydrophobic domain is a potential furin proteolytic cleavage site (Arg-Arg-Arg-Arg) (Hosaka et al., 1991). This motif, first noted in a porcine zona protein (Yurewicz et al., 1993), is also present in mouse ZP2 and ZP3 (Fig. 2). The next 277 amino acids upstream of the potential furin cleavage site (residues 268-544) are 47% similar (34% identical) to a similar region of mouse ZP2 (residues 363-635), but not to ZP3, as indicated by the horizontal line in Fig. 2. Like ZP2 and ZP3, secreted ZP1 is heavily glycosylated. Its predicted polypeptide chain contains 6 potential N-glycosylation sites and more than 93 (serine and threonine) potential O-glycosylation sites (Fig. 1).

Rabbit rc55 encodes R55, a major component of the rabbit zona pellucida (Schwoebel et al., 1991). However, preliminary hybridization studies with rc55 cDNA and mouse genomic DNA did not detect cross-hybridizations between the two species, even under low-stringency wash conditions. Now, however, the independent cloning of mouse ZP1 confirms that rabbit rc55 and mouse ZP1 are homologues, and the relatively low nucleic acid identity may have accounted for the lack of Ncross-hybridization. Mouse ZP1 (623 amino acids) is significantly longer than rabbit R55 (540 amino acids), a difference that is mostly accounted for by a 77 amino acid region in the amino-terminal third of the mouse protein that is not present in the rabbit protein (Fig. 3). Overall similarity of the 427 aligned residues in the two polypeptide chains is 51% with a central core of 225 amino acids that have 66% similarity (53% identity). Fifteen cysteine residues present in the mouse ZP1 are precisely aligned in rabbit R55 with an additional three non-aligned cysteine residues being present near the N terminus of the mouse protein (Fig. 3). This degree of conservation of sequence and placement of cysteine residues suggests that the three-dimensional structure of mouse ZP1 and rabbit R55 is conserved as well. Whether or not the two proteins have the same biological role in fertilization remains an area for future investigations.

Poly (A)⁺ RNA was isolated from ovary, brain, heart, liver, kidney, spleen and testis. Using a ³²P-labelled ZP1 cDNA probe in a northern blot analysis, a single 2.15 kb signal was detected only in the ovary (Fig. 4). Assuming a poly(A) tail of 150-200 nt, the size of the mouse ZP1 transcript corresponds to the size of the 1963 nt full-length cDNA described above. As a control, the northern blot was reprobed with a labelled actin cDNA and actin transcripts were detected in all tissues (data not shown). Earlier studies had determined that the expression of mouse ZP2 and ZP3 genes is similarly restricted to the ovary (Ringuette et al., 1986; Liang et al., 1990).

To localize zona gene expression further to a specific cell type, ovaries from 13-day-old mice were fixed, sectioned and hybridized in situ with sense and antisense ³³P-labelled RNA probes specific to mouse ZP1, ZP2 and ZP3 (Figs 5,6). Mouse ZP1 transcripts were readily detected in growing oocytes where they are present diffusely in the cytoplasm. Although present in the earliest growing oocytes, their abundance appears to increase as the oocytes grow. The hybridization signal over granulosa cells and resting oocytes was no greater than background. ZP2 transcripts were also present in growing oocytes, where they appear as an abundant mRNA; again, no hybridization signal above background was observed in granulosa cells. Additionally, hybridization signals were detected in resting oocytes probed for ZP2 (arrows, Fig. 6D,E), but not in resting oocytes probed for ZP1 or ZP3 (Fig. 6A,B,G,H). In confirmation of an earlier report (Philpott et al., 1987), ZP3 transcripts hybridized exclusively to growing oocytes and not to granulosa cells. Thus, at the limit of detection using ³³P-antisense RNA probes in an in situ hybridization assay, none of the three zona transcripts were detected in granulosa cells. Only ZP2 transcripts were detected in resting oocytes in amounts greater than background. Control ZP1, ZP2 and ZP3 sense probes did not demonstrate any specific hybridization to growing oocytes (Fig. 6C,F,I).

The temporal accumulation of the three zona transcripts during oogenesis was determined by a RNase protection assay using a mixture of zona-specific probes (Fig. 7A). Fifty oocytes at different stages of growth and maturation were isolated, analyzed and the protected probe fragments were separated by denaturing-PAGE. Although no zona transcripts were apparent in RNA isolated from 50 or 800 resting oocytes shown in Fig. 7B (lane 2,3), using prolonged exposure times for autoradiography, low levels of ZP2 (but not ZP1 or ZP3) were detected in RNase protection assay samples containing 800 resting oocytes (data not shown). This is in accord with the in situ hybridization data (Fig. 6D,E), where the signal was present in the primordial oocytes. No protection was observed with yeast RNA, confirming the specificity of the hybridization (Fig. 7B, lane 1).

As the oocyte begins to grow, ZP1, ZP2 and ZP3 transcripts accumulate coordinately and reach maximum levels in mid-sized oocytes (50-60 μm in diameter), before declining in the later stages of oocyte growth (Fig. 7B). By comparing the intensity of the RNAse protection signal in oocyte samples with that obtained from known amounts of synthetic zona transcripts, the accumulation of zona transcripts can be quantified (Fig. 7C). At their maximum, each oocyte contains approximately 0.24±0.016 (s.e.m.), 0.82±0.10, and 1.0±0.11 attomoles of ZP1, ZP2 and ZP3 transcript, respectively. Low levels (less than 5% of peak values) of each transcript can still be detected in metaphase II ovulated eggs. These data indicate that the stoichiometry of ZP1, ZP2 and ZP3 transcripts is approximately 1:4:4. The overall time course suggests that expression of the zona pellucida genes is coordinately regulated in an oocyte-specific manner to ensure the availability of zona transcripts during oogenesis.

The site of zona pellucida biosynthesis has been controversial almost since the zona matrix was first described more than 100 years ago. Some investigators have identified oocytes as the source (Kang, 1974; Haddad and Nagai, 1977; Bousquet et al., 1981; Flechon et al., 1984; Leveille et al., 1987), whereas others have localized zona biosynthesis to the surrounding granulosa cells (Chiquoine, 1954; Hadek, 1965). In metabolic studies, isolated oocytes devoid of granulosa cells, when cultured in the presence of radioactive precursors, synthesize de novo ZP1, ZP2 and ZP3 (Bleil and Wassarman, 1980c); morphologic studies demonstrate that mouse oocytes misdirected to the adrenal gland (and lacking granulosa cells) nevertheless produce a zona pellucida (Zamboni and Upadhyay, 1983). Although these studies demonstrate the ability of the oocyte to synthesize zona proteins by itself, they do not address whether or not granulosa cells produce zona proteins as well.

The cloning of cDNAs encoding zona proteins and the development of immunologic probes to specific zona components have permitted more molecular investigations of this question. However, these more recent studies have examined only a single zona protein or transcripts under different experimental conditions, making direct comparisons difficult. For example, in situ hybridization studies of mouse (Philpott et al., 1987) and marmoset (Koothan-Thillai et al., 1993) ovaries detected ZP3 transcripts in oocytes, but not in granulosa cells. Immunohistochemical studies with a monoclonal antibody to mouse ZP2 (East and Dean, 1984) and polyclonal antisera to a mouse ZP3 peptide (Millar et al., 1989) detected zona proteins only within the zona matrix. However, other immunohistochemical studies (Wolgemuth et al., 1984) and northern blot analysis of granulosa cells grown in culture for 5 days (Lee and Dunbar, 1993) report the presence of rabbit rc55 transcript and protein in granulosa cells. Since the initial cloning of cDNAs encoding mouse ZP3 (Ringuette et al., 1986, 1988), mouse ZP2 (Liang et al., 1990) and rabbit rc55 (Schwoebel et al., 1991), it has been proposed that these three cDNAs encode prototypes of each of the three zona proteins. Thus, the different results described above might reflect differences among mammals or might reflect differences among the three zona proteins. To resolve this issue in the mouse, we have characterized ZP1 and demonstrated that it is the mouse homologue of rabbit rc55. Using the three mouse zona probes, we simultaneously assessed the temporal, spatial and quantitative aspects of zona gene expression during mouse oogenesis.

By northern blot analysis, the three zona transcripts were detected in ovary and not in six other tissues, including testis (this paper and Ringuette et al., 1986; Liang et al., 1990). Using in situ hybridization and ³³P-labelled probes, the expression of all three zona transcripts were further localized to oocytes. No signals above background were detected in granulosa cells. To our knowledge, there are no published accounts of the sensitivity of ³³P-labelled probes used in in situ hybridization. However, it is reported that the signal-to-noise ratio is 10-50 times better than with ³⁵S-labelled probes (McLaughlin and Margolskee, 1993), which can detect as few as 10-14 transcripts per cell (Arcellana-Panlilio and Schultz, 1994). Thus, we conclude that in vivo expression of the mouse zona transcripts is restricted to oocytes. The brief report of rabbit rc55 in growing oocytes, but not in granulosa cells, by in situ hybridization of rabbit ovary (Dunbar et al., 1995) suggests that this may be true in the rabbit as well. A possible explanation of the paradoxical detection of rc55 by northern blot in granulosa cells grown in vitro (Lee and Dunbar, 1993), but not by in situ hybridization of ovarian sections, is that the rc55 gene might be derepressed in granulosa cells grown in the absence of oocytes.

Our results also indicate that the three zona pellucida genes exhibit an ordered pattern of expression during oogenesis. ZP2 transcripts are detected in oocytes before birth, well before the growth phase of oogenesis and perhaps as early as 16 days gestation (Millar et al., 1993). In the current study, ZP2 transcripts were detected by in situ hybridization in roughly 90% of the resting oocytes whereas ZP1 and ZP3 transcripts were detected only after the oocytes begin to grow. Whether the early detection of the ZP2 transcript reflects a relative abundance (e.g., ZP1 and ZP3 are present but at levels below the sensitivity of the assay) or an earlier onset of Zp2 gene expression (e.g., Zp1 and Zp3 genes are not yet activated) remains to be determined. As the diameter of the oocyte increases, all three zona transcripts accumulate, and in mid-sized oocytes (50-60 μm diameter) represent approximately 1.5% of the total poly(A)⁺ RNA. The accumulation of the ZP1, ZP2 and ZP3 RNAs appears coordinate, with a dramatic increase during the early stages of oogenesis and then a decline as the oocyte matures. In mature oocytes, the zona matrix is fully formed and appears to be quite stable (Shimizu et al., 1983). After ovulation, eggs have less than 5% of the peak levels of zona transcripts. ZP1 is the least abundant of the three transcripts, representing approximately 25% of ZP2 or ZP3 RNAs, which are present in roughly equimolar amounts. These data suggest that the three zona genes may have transcriptional regulatory elements in common. Analysis of the promoter region of the Zp2 and Zp3 genes has identified a binding site for a putative transcription factor Zona Activating Protein (ZAP-1) implicated in the regulation of zona gene expression (Millar et al., 1991, 1993). It remains to be determined if ZAP-1 is also involved in the regulation of Zp1.

The primary structure of ZP1 has been deduced from a full-length cDNA of mouse ZP1. Comparison of its amino acid sequence with that of rabbit R55 confirms that the two proteins are orthologues. Gel electrophoretic analysis of mouse ZP1 (Bleil and Wassarman, 1980b; Shimizu et al., 1983) and rabbit R55 (Dunbar et al., 1981) suggests that each protein is heavily glycosylated. Mouse ZP1 is present in the extracellular matrix as a high molecular weight protein (180-200×10³) which, under reducing conditions, has an apparent mass of 120×10³M_r. In contrast, rabbit R55 appears as a broad band (90×10³M_r) resolved only by 2-dimensional electrophoresis whose mobility changes little after reduction of disulfide bonds. These data suggest that mouse ZP1 (but not rabbit R55) is dimerized via disulfide bonds. The detection of a single N-terminal sequence after microsequencing of the secreted protein further suggests that ZP1 exists as a homo-rather than a heterodimer. It is tempting to speculate that the three cysteine residues present in native mouse ZP1 (but not rabbit R55) are involved in ZP1-ZP1 dimerization. Presumably, the remaining 15 conserved cysteine residues present in both proteins are involved in maintaining the three-dimensional structure of ZP1 (and R55) in the zona matrix.

Although distinct from mouse ZP2 and ZP3, ZP1 shares certain motifs with the other two zona proteins. Each of the three proteins has a signal peptide that directs it into a secretory pathway and is cleaved from the mature polypeptide chain. Each zona protein has a transmembrane domain near its carboxyl terminus about 40 amino acids downstream of a potential furin cleavage site. The proteolytic processing of the transmembrane domains may be an intermediate step in the secretion of the zona proteins. Accumulating evidence suggests that specific protein domains have been conserved among zona classes of each mammal and among widely divergent species. Ending at the aforementioned potential furin cleavage site, mouse ZP1 shares a 277 amino acid domain with mouse ZP2. This domain, first noted between rabbit rc55 and mouse ZP2 (Schwoebel et al., 1991), is also present in a chorion protein surrounding teleost eggs that is synthesized in and secreted from the liver after estrogen induction (Lyons et al., 1993). Thus, it appears that this motif has persisted over approximately 650 million years of evolution in egg envelope proteins.

The isolation of full-length cDNAs encoding each of the three mouse zona proteins provides the possibility of creating a zona pellucida in vitro. Recombinant mouse ZP3 (Kinloch et al., 1991; Beebe et al., 1992) and ZP2 (A. Ginsberg, unpublished observations) have been expressed in mammalian cells. Both proteins are soluble and recombinant ZP3 has in vitro biologic activity; it can induce the acrosome reaction and inhibit sperm binding to ovulated eggs. Efforts are currently underway to create cell lines expressing all three zona proteins to determine if an insoluble zona matrix can be recreated in vitro and ascertain whether or not it has biologic function. If successful, the synthetic zona matrix would be particularly useful for investigations of the structural interactions that lead to formation of a biologically active zona pellucida.

We are grateful to Dr Zhi-Bin Tong for help in making the antiserum, to Drs Kathleen Mahon and Rosemary Bachvarova for providing their expert guidance for the in situ hybridization, to Dr Bonnie Dunbar for providing a rabbit rc55 cDNA clone and to Dr Robert McIsaac for his invaluable advice. We appreciate the critical reading of the manuscript by Drs Rosemary Bachvarova, Ann Ginsberg and Robert McIsaac. O. E. is supported by postdoctoral fellowships from ‘Instituto Pasteur-Fondazione Cenci Bolognetti’ and from ‘Stiftelsen Blanceflor Boncompagni-Ludovisi, nee Bildt’.