Calcium fluxes in dorsal forerunner cells antagonize β-catenin and alter left-right patterning

Although vertebrates appear bilaterally symmetrical from the outside, the heart, lungs, liver and gut are carefully positioned across the left-right(LR) axis, and the development of this asymmetry is highly conserved across species. Deviations from the normal internal organ LR arrangement can cause lethality and congenital heart defects (reviewed by Bisgrove et al., 2003). Embryonic organ laterality is preceded by molecular and physiological asymmetries. Asymmetrical H⁺/K⁺-ATPase expression and gap junctional communication in early cleavage stage Xenopus embryos have been proposed to modulate LR signals but may be species specific(reviewed by Levin and Palmer,2007). During somite stages, asymmetrical gene expression in the lateral plate mesoderm (LPM) becomes apparent. Of note is the left-sided LPM expression of the secreted transforming growth factor-β (TGFβ)related factor nodal, a conserved feature in all vertebrate species examined to date (reviewed by Ahmad et al.,2004). Likewise, downstream targets of nodal, including lefty1 and pitx2, have conserved asymmetric expression(reviewed by Hamada et al.,2002; Raya and Belmonte,2006; Wright and Halpern,2002). Asymmetrical nodal expression and LR axis determination in post-gastrula embryos are correlated with the proper structure and function of monocilia located in the embryonic node. Rotation of these monocilia generates a leftward fluid flow in the lumen of the node and is thought to be required for proper LR asymmetry(Hirokawa et al., 2006; Nonaka et al., 1998; Okada et al., 1999). Despite the identification of multiple LR signals, the degree of conservation, as well as the integration and coordination of these independent physiological and molecular signals, is not clearly defined.

In the zebrafish, a structure called Kuppfer's Vesicle (KV) is structurally and functionally homologous to the node, and cilia in the KV are thought to generate critical laterality signals that are propagated to the LPM. The KV is derived from a cluster of non-involuting cells called the dorsal forerunner cells (DFCs), which migrate ahead of the dorsal blastoderm during gastrulation. These cells contribute to both the tailbud and the KV during somite stages (Cooper and D'Amico,1996; Melby et al.,1996). Furthermore, the DFCs express several genes required for LR patterning and ablation of DFCs disrupts LR patterning(Amack and Yost, 2004; Essner et al., 2005).

Studies in several vertebrate model organisms implicated a requirement for Ca²⁺ signals in LR asymmetry, downstream of fluid flow in the node(Hirokawa et al., 2006) and/or of H⁺/K⁺ ATPase activity (reviewed by Tabin, 2006). Leftward fluid flow within the node, generated by left-right dynein containing cilia, is thought to stimulate mechanosensory cilia at the node periphery. These cilia contain polycystin-2/PKD-2, a Ca²⁺-permeable cation channel, and their stimulation triggers elevated intracellular Ca²⁺ levels at the left edge of the mouse node (McGrath et al., 2003). In zebrafish, Ca²⁺ fluxes near the zebrafish KV have been reported and are proposed to be required for normal LR patterning (Sarmah et al.,2005). Additionally, zebrafish embryos mutant for pkd2have disrupted expression of laterality markers and organ laterality defects(Schottenfeld et al., 2007). Although the mouse and zebrafish loss-of-function phenotypes are not identical, both models implicate a role for Ca²⁺ release. In an alternative mouse model, the leftward flow of vesicular particles containing sonic hedgehog (shh) has been postulated to act in a distinct atypical signaling pathway to activate Ca²⁺ on the left side of the node (Tanaka et al.,2005). Elevated Ca²⁺, in either case, is thought to act via an unknown mechanism, to induce left-sided gene expression(Brennan et al., 2002; Hashimoto et al., 2004; Marques et al., 2004).

In contrast to intracellular Ca²⁺ release, a role for left-sided elevation of extracellular Ca²⁺ has also been proposed. In the chick, differential H⁺/K⁺ ATPase activity is thought to set up a spatial gradient of extracellular Ca²⁺ by the end of gastrulation, which may be sensed by Notch to activate asymmetrical gene expression (Raya et al.,2004). In zebrafish, disruption of H⁺/K⁺ATPase activity also leads to LR asymmetry defects(Kawakami et al., 2005) and disrupts KV cilia number and length (Adams et al., 2006). However, in these studies, it was unclear whether intracellular Ca²⁺ was also increased on the left side of the node/KV. Also, in the case of H⁺/K⁺ ATPase inhibition, shh was induced ectopically, an event which could influence laterality.

Thus, several vertebrate models implicate a role for Ca²⁺signaling in LR asymmetry (Shimeld,2004), and the data are consistent with a function downstream of H⁺/K⁺ ATPase or node/KV cilia during somitogenesis. However, it has not been determined whether Ca²⁺ release also has a role in parallel or upstream to KV/node formation and function. In this study,we identified endogenous Ca²⁺ release in the DFC region after the onset of gastrulation, distinct from the events described above and prior to cilia and KV formation. We show that transient inhibition of this Ca²⁺ release results in altered expression of asymmetric markers such as southpaw, lefty1/2 and pitx2, randomized placement of organs relative to the LR axis, all preceded by the reduction/loss of KV formation. We further provide several lines of evidence to suggest that the regulation of β-catenin activity is a critical target of Ca²⁺in the DFCs. First, we show that inhibition of Ca²⁺ release in the DFC region causes a marked increase in nuclear β-catenin andβ-catenin transcriptional activity. Second, targeted activation ofβ-catenin in the DFCs is sufficient to alter laterality. Finally, we describe cells with DFC-like properties in Xenopus and establish that the epiboly/gastrula Ca²⁺-sensitive event is conserved in frogs, as a pulse of Ca²⁺ inhibition in Xenopus leads to altered organ laterality and nodal expression as well as ectopic accumulation ofβ-catenin. Thus, in addition to conserved node-like/cilia development in fish and frog, our results indicate a conserved early Ca²⁺requirement in LR patterning.

Zebrafish embryos were collected from natural spawning. Embryos were rinsed with embryo medium (Westerfield,1995) and staged according to Kimmel et al.(Kimmel et al., 1995). Live embryos were photographed after orienting in 3% methylcellulose. Xenopus eggs recovered from females were fertilized in a sperm suspension and maintained in 0.1× MMR.

Thapsigargin (2.5 μM; Molecular Probes), BODIPY-FL-Thapsigargin (2.5μM; Molecular Probes), Cyclopiazonic Acid (200 μM; Calbiochem) or Valproic Acid (0.2 mM; Sigma) were diluted in embryo medium. Zebrafish embryos were incubated in thapsigargin for the indicated time and then washed three times in embryo medium. Xenopus (stage 11.5) were incubated for 20 minutes in thapsigargin. Xestospongin C (1-2 μM; Calbiochem), was co-injected with Texas Red lineage marker (Molecular Probes) into the yolk of 256- to 512-cell embryos.

Control: CCTCTTACCTCAGTTACAATTTATA and Axin1: ACTCATGCTCATAGTGTCCCTGCAC MOs were purchased from Gene Tools, LLC. MO (8 ng) or in vitro transcribedβ-catenin 55C RNA (70-100 ng/μl) was co-injected with Texas Red lineage marker (Molecular Probes) into the yolk of 256-512 cell embryos.

Zebrafish cardiac jogging and looping was assessed by light microscopy or by WISH with nkx2.5. Gut looping was determined by foxA3 at 48-52 hpf. Xenopus heart and gut orientation was scored under a light microscope (stage 44-46) and laterality was monitored by xnr1expression (stage 22-24). For all manipulations, embryos were fixed in 4%paraformaldehyde/1×PBS. Digoxygenin-labeled RNA probes (Roche) were synthesized using linearized templates and the appropriate RNA polymerase. Zebrafish and Xenopus hybridizations were done as described(Long et al., 2003; Houston and Wylie, 2005).

Zebrafish embryos were injected with either TopFlash or FopFlash as previously described (Park and Moon,2002), incubated until epiboly stage and treated with thapsigargin or DMSO for 10 minutes at 60% epiboly. After three to five washes with embryo medium, excess medium was removed and embryos were flash frozen at the indicated time (20 or 60 minutes after drug application). Triplicate samples of 15 embryos each were used for TopFlash/FopFlash dual luciferase assays performed following manufacturer instructions (Promega). Luminescence was detected in a Turner Biosystems 20/20n Luminometer.

Immunofluorescence was performed according to a standard protocol using anti-acetylated tubulin (Sigma), β-catenin (Sigma) or Ntl (a gift from Dr D. J. Grunwald, University of Utah) followed by fluorescent secondary antibody(Alexa Fluor 488, Molecular Probes) or conjugated anti-horseradish peroxidase(Jackson ImmunoResearch). Confocal image stacks collected at 2 μm intervals were evaluated for nuclear β-catenin.

Syto-11 (Molecular Probes) was diluted in embryo medium to a final concentration of 7.5 μM. Control solution was 2% DMSO in embryo medium. Zebrafish (70% epiboly) and Xenopus (stage 11.5) were soaked in Syto-11 for 30 minutes and washed out with excess medium.

Zebrafish embryos (one-cell) injected with Fura-2 (dextran-conjugated,Molecular Probes) were oriented with the dorsal shield location noted before collection. The instrumentation for data collection, image analysis software and data manipulations were as described(Slusarski and Corces,2000).

As the morphogenetic movements of epiboly progresses, additional cell movements of gastrulation occur, such as involution, convergence and extension, to produce the primary germ layers and the embryonic axis. Ca²⁺-release activity has been described during epiboly/gastrula stages in both zebrafish and Xenopus(Gilland et al., 1999; Wallingford et al., 2001; Webb and Miller, 2006). During epiboly, zebrafish embryos are staged by the extent to which cells have moved over the yolk. At 50% epiboly, the embryonic dorsal shield forms as a thickening on the future dorsal side(Kimmel et al., 1995). The DFCs lie just below the shield and migrate ahead of the shield during gastrulation. At the completion of gastrulation, the DFCs come to lie between the yolk and tailbud and will form the epithelial lining of the KV.

To visualize spatial and temporal changes in live embryos during epiboly/gastrulation, we used the ratiometric Ca²⁺ sensor Fura-2, a reliable measure of intracellular Ca²⁺(Grynkiewicz et al., 1985). As described in the introduction, Ca²⁺ indicators have been used to investigate the role of Ca²⁺ in LR patterning. Most of the commonly used Ca²⁺ indicators utilize single wavelength excitation and have the potential to interpret signal artifacts as Ca²⁺-dependent changes. Dual-wavelength detection of Fura-2 has reduced sensitivity to signal artifacts and enables quantitative measurement of Ca²⁺concentrations. In addition, Fura-2 is less prone to photobleaching (the irreversible destruction of fluorophores) allowing for extended imaging over a developmental time point. Using Fura-2 imaging in zebrafish, we detected localized Ca²⁺ release activity in the shield/DFC region between 60-90% epiboly. In a lateral view of a bright field image, the DFCs resided at the leading edge ahead of the shield region(Fig. 1A, arrow). A single frame of the raw Fura-2 fluorescence of an embryo in a lateral orientation with the shield to the right (Fig. 1B, arrow) and the associated ratio image(Fig. 1C, arrow) demonstrates localized Ca²⁺ release activity in the region of the DFCs. The transient Ca²⁺ release in the DFC region was most active during 60-70% epiboly and became less active after 75-80% epiboly (see Movie 1 in the supplementary material).

Next, we determined whether a specific developmental process was impacted by experimental suppression of Ca²⁺ release during this time window. To this end, we used thapsigargin, a membrane permeable Ca²⁺-ATPase inhibitor that prevents the pumping of Ca²⁺back into the endoplasmic reticulum, resulting in transient increases in cytoplasmic Ca²⁺, but ultimately causing depletion of internal Ca²⁺ stores (Thastrup et al.,1990; Thastrup et al.,1994). Epiboly stage zebrafish embryos were incubated in thapsigargin at different doses (data not shown) and for different lengths of time (Fig. 1D). The optimal dose was determined to be 2.5 μM thapsigargin for 10 minutes and treatment after 60% epiboly, coinciding with the stages of local Ca²⁺ fluxes observed in the DFC region (see Movie 1 in the supplementary material). Embryos treated at that stage showed normal axial (anterior-posterior and dorsal-ventral) patterning (Fig. 1F,G), but displayed altered LR asymmetry as evaluated by heart jogging (see below; Fig. 1E). Doubling the exposure time did not have any substantial impact upon LR patterning above the optimal treatment(Fig. 1E). Thus, we conclude that brief exposure to thapsigargin after the 60% epiboly stage targets local short-term (or high threshold) signaling, leaving global Ca²⁺release relatively unperturbed and thereby allowing normal axial patterning. We next explored the nature of the laterality defects and whether DFC differentiation or morphogenesis was affected.

Heart jogging is one of the first morphological indications of organ LR asymmetry in zebrafish. At 24-30 hpf, the heart tube elongates from the midline and bends, or `jogs', to the left. To evaluate heart asymmetry embryos can be scored for leftward, rightward or no jog bias(Chen et al., 1997). In untreated, wild-type (wt), embryos, the heart jogged to the left in 95% of the embryos (Fig. 1H and Fig. 2A). In thapsigargin-treated embryos, jogging was randomized, as the heart tube migrated leftward (43%), rightward (25%), or remained in the middle (32%)(Fig. 1H and Fig. 2A-C). A conserved aspect of LR asymmetry among vertebrates is a later morphological looping of the heart, which typically forms a D-loop that places the zebrafish ventricle anterior and to the right of the atrium. In thapsigargin-treated embryos there was concordance between cardiac jogging and looping (see Table S1 in the supplementary material).

If Ca²⁺ inhibition during epiboly disrupts a key LR signal, then the placement of other asymmetrically oriented organs, in addition to the heart, should be altered. This could manifest itself either as heterotaxia(organs adopting laterality independently), or as concordance, which can lead to situs inversus totalis (reversal of all organ LR asymmetries). Embryos sorted by heart jogging were stained for foxA3 expression, a larval gut marker (Fig. 1H and Fig. 2D-F) and we found a tight correlation between heart jogging and gut positioning. These results show that organ laterality defects tend to be coordinated in thapsigargin-treated embryos.

To determine whether the randomized organ asymmetry is preceded by alteration of underlying molecular cues, we analyzed several LR markers. The zebrafish nodal-related gene southpaw (spaw)(Long et al., 2003) is the earliest asymmetrical marker in the left LPM during somitogenesis (14-21 hpf). At the 4-6 somite stage, spaw expression initiated flanking the KV and this early expression was maintained in thapsigargin-treated embryos (see Fig. S1 in the supplementary material). However, the later asymmetric spaw expression in the LPM was dramatically altered in thapsigargin-treated embryos with only a small percentage showing left-sided expression (Fig. 2G-I) compared with wt and control embryos (Fig. 2P). We next investigated markers induced by asymmetric spaw, including lefty1, lefty2 and pitx2c (reviewed by Ahmad et al., 2004). In wt and control embryos, lefty1 was expressed in the left anterior LPM(overlapping the prospective heart field)(Fig. 2J), but in treated embryos, expression was predominantly bilateral(Fig. 2K) or reversed. In the developing brain, pitx2c and lefty1 were transiently expressed in the left dorsal diencephalon(Halpern et al., 2003). Wt and control embryos showed left-sided lefty1(Fig. 2J), whereas thapsigargin-treated embryos showed altered lefty1 brain expression(Fig. 2K). Likewise, lefty2 and pitx2c expression was severely disrupted in treated embryos (Fig. 2P and see Fig. S1 in the supplementary material). Thus, thapsigargin treatment disrupts normal asymmetric expression of known molecular cues.

The dorsal midline (notochord and floorplate) is important as a barrier for laterality signals and any gaps in the midline barrier can lead to bilateral spaw expression (Bisgrove et al.,2000; Danos and Yost,1996; Meno et al.,1998). Thus, we evaluated midline integrity in treated embryos. DIC optics in live embryos (Fig. 1G, data not shown) as well as prechordal/notochord expression in the goosecoid-GFP transgenic line(Doitsidou et al., 2002)showed normal midline patterning (see Fig. S2 in the supplementary material). At the molecular level, we evaluated three independent notochord and/or floorplate markers (lefty1, ntl and shh) and all three were normal in thapsigargin-treated embryos(Fig. 2J-O). In the case of ntl, we evaluated both RNA (Fig. 2L,M) and protein distribution (see Fig. S2 in the supplementary material). Since ntl, lefty1 and shh have essential functions associated with the midline and were expressed, these analyses confirm that brief (10 minute) thapsigargin treatment does not compromise the integrity of dorsal midline tissues.

Thapsigargin treatment of zebrafish embryos yielded dramatic alteration to laterality without alteration to the midline. Typically thapsigargin treatment results in inhibition of Ca²⁺ release. Nevertheless, other studies use thapsigargin to increase Ca²⁺ levels, in particular those that investigate capacitative Ca²⁺ release. To determine whether thapsigargin led to an increase or a loss of the DFC regional Ca²⁺activity, we performed Fura-2 image analysis in zebrafish embryos at the time of treatment. After application of thapsigargin, we observed suppression of the DFC-regional Ca²⁺ fluxes (see Movie 2 in the supplementary material). The loss of the DFC Ca²⁺ release activity upon thapsigargin treatment supports a role for intracellular Ca²⁺ in a subset of cells during epiboly.

To substantiate the necessity of DFC regional Ca²⁺, we tested additional reagents that suppress Ca²⁺ release including:cyclopiazonic acid, a reversible inhibitor of Ca²⁺-ATPase(Seidler et al., 1989), and valproate, an inhibitor of inositol turnover, targeting the phosphatidylinositol (PI) cycle (Eickholt et al., 2005) as well as Xestospongin C (XeC), a compound that inhibits IP₃-induced Ca²⁺ release(Gafni et al., 1997). All three reagents, cyclopiazonic acid, valproate and XeC, alter heart jogging in treated embryos (data not shown). Embryos treated with valproate and evaluated for asymmetrical gene expression demonstrated altered leftyexpression (see Fig. S3 in the supplementary material). Taken together, these data support a requirement for Ca²⁺ release in the DFCs for appropriate laterality.

Since the DFCs are located in the region of endogenous Ca²⁺release activity, we investigated DFC specification, migration and endocytic activity after thapsigargin treatment. Several molecular markers are expressed in the DFCs during epiboly (squint, left-right dynein-related-1/lrdr1,ntl and sox17) (Alexander and Stainier, 1999; Essner et al.,2002; Feldman et al.,1998; Schulte-Merker et al.,1994). We focused on these markers because three of these genes(lrdr1, ntl and squint) are required for proper LR patterning and sox17 can be used to evaluate morphogenesis. In thapsigargin-treated embryos, robust DFC sox17 expression was observed at 80% epiboly in a linear domain as opposed to an ovoid shape observed in controls (Fig. 3A,B). lrdr1 expression at 80% epiboly was similar in wt and thapsigargin-treated embryos (see Fig. S4 in the supplementary material). squint expression, a zebrafish nodal-related gene, was also maintained (data not shown). DFCs expressed both ntl RNA (see Fig. S4 in the supplementary material) and Ntl protein in thapsigargin-treated embryos but the cells did not expand over the yolk as much as in the control(Fig. 3C,D). The presence of early DFC markers supports the fact that Ca²⁺ inhibition does not interfere with the specification of the DFCs. However the compact DFC domain at later epiboly suggests that DFC behavior and or migration may be altered.

Since DFCs are highly endocytic and readily take up vital dyes, such as Syto-11 (Cooper and D'Amico,1996), we determined whether this aspect of DFC function was affected. Control and thapsigargin-treated embryos incubated in Syto-11 showed similar DFC dye uptake, as visualized by fluorescent microscopy. In thapsigargin-treated embryos, Syto-11 uptake and early migration to the tailbud region was similar to control-treated embryos (see Fig. S4 in the supplementary material). We next monitored DFC migration in vivo by using a GFP transgenic line that marks the DFCs. In the Dusp6:d2EGFPtransgenic line, EGFP was expressed in a fibroblast growth factor(FGF)-responsive manner in several tissues including the KV and its progenitors (Molina et al.,2007). We directly visualized DFC migration in live embryos from 80% epiboly to four-somite stage (see Movie 3 in the supplementary material). Migration during epiboly was similar in wt and thapsigargin-treated embryos(Fig. 3G,H). By the tailbud to one-somite stage in wt, the DFCs formed a circular cluster at the midline(Fig. 3I) whereas thapsigargin-treated embryos displayed a smaller midline cluster with individual cells scattered nearby (Fig. 3J and see Movie 4 in the supplementary material). By the three-to five-somite stage in wt, the DFCs formed the circular precursor of the KV(Fig. 3K), but in thapsigargin-treated embryos, there was increased dispersal(Fig. 3L).

Evaluation of DFC markers, lrdr1 and sox17, demonstrated a similar migration pattern. DFC migration in thapsigargin-treated embryos appeared the same as in the control during early epiboly but showed increased dispersal of individual cells during somite stages (see Fig. S4 in the supplementary material). Use of another inhibitor, XeC, also resulted in increased dispersal of DFCs, as assayed by the distribution of sox17(Fig. 3F). sox17 is expressed in the endoderm as well as in the DFCs and endodermal expression is similar in control and thapsigargin-treated embryos(Fig. 3A,B). Thus, transient Ca²⁺ inhibition specifically affects the DFCs, and not overall sox17 expression. These data support the conclusion that inhibition of Ca²⁺ release does not perturb DFC specification, endocytic activity or early migration, but rather is required for later migration or coalescence.

The DFCs are KV progenitors (Cooper and D'Amico, 1996; Melby et al.,1996), and thapsigargin treatment resulted in a dramatic loss of a visible KV, with 97% severely reduced or absent(Fig. 4A-D). Thapsigargin-treated embryos also displayed reduced or absent cilia in the KV region (see Fig. S4 in the supplementary material). A subset of KV cells expressed Charon, a Nodal antagonist of the Cer/Dan protein class(Hashimoto et al., 2004). During somite stages, charon expression appeared as a horseshoe shape in the tailbud (Fig. 4E)whereas the pattern in thapsigargin-treated embryos was severely reduced(Fig. 4F) or absent(Fig. 4A,G). Thus, loss of the endogenous Ca²⁺ flux during epiboly eliminates charonexpression and disrupts formation of the KV.

In zebrafish, we previously demonstrated an antagonistic relationship between Ca²⁺ signaling and β-catenin activation(Westfall et al., 2003b). Consequently, we explored the possibility that β-catenin stability may be a target of Ca²⁺ signaling in the DFC region. After 10 minutes of thapsigargin treatment, embryos were washed, cultured until 80% epiboly (50 minutes after treatment) and fixed for immunolocalization. Confocal analysis of β-catenin distribution on both sides of control-treated and wt embryos displayed sporadic cells with nuclear β-catenin in the enveloping layer(EVL) and the yolk syncytial layer (YSL)(Fig. 5A). The EVL, which forms an epithelial monolayer covering the blastoderm, and the YSL, which resides at the blastoderm/yolk margin, are regions where endogenous Ca²⁺release has previously been detected(Reinhard et al., 1995; Slusarski et al., 1997) and both layers contribute to the DFCs (Cooper and D'Amico, 1996). A marked increase of β-catenin-positive nuclei was observed in thapsigargin-treated embryos(Fig. 5B). Focusing on the DFC-region, there was little or no nuclear β-catenin in wt embryos(Fig. 5C). In contrast, the DFC region of thapsigargin-treated embryos displayed nuclear β-catenin(Fig. 5D). Student's t-test analysis of the average number of β-catenin-positive nuclei demonstrated a statistically significant, eightfold increase, in thapsigargin-treated compared with untreated embryos(Fig. 5F). To confirm that ectopic nuclear β-catenin is transcriptionally active, we used TopFlash reporter analyses. TopFlash or FopFlash control vectors were injected into embryos, which were then treated with thapsigargin or control reagent. At 80%epiboly, reporter activity was assayed via relative luminescence units(normalized for Renilla control) and TopFlash-injected embryos, but not FopFlash, showed a striking, statistically significant increase after thapsigargin treatment (Fig. 5G). The increased reporter activity at this stage supports the conclusion that thapsigargin treatment leads to transcriptionally active,ectopic β-catenin. Increased TopFlash activity was observed as early as 20 minutes after thapsigargin application (see Fig. S5 in the supplementary material), suggesting a direct response to Ca²⁺ inhibition. For in vivo confirmation of β-catenin activation, we used transgenic embryos expressing destabilized GFP under the control of a β-catenin-responsive promoter, TOPdGFP (Dorsky et al.,2002). In wt embryos at 80% epiboly, there was active Wnt/β-catenin signaling in ventral-lateral domains, reflected by robust TOPdGFP expression, and minimal signal in the DFC region. Thapsigargin treatment induced ectopic GFP expression in the DFCs and flanking regions (see Fig. S5 in the supplementary material).

To determine whether activated β-catenin is sufficient to disrupt LR patterning we targeted a stabilized β-catenin construct [βcat55-C(Pelegri and Maischein, 1998)]to the DFCs, using a procedure developed by Amack and Yost(Amack and Yost, 2004). In this method, reagents injected into the yolk of 256- to 512-cell stage embryos were preferentially taken up by the YSL and DFC progenitors, which maintain cytoplasmic bridges with the yolk cell (DFC-targeting). In our hands, the injections successfully targeted the DFCs with 20-40% efficiency as measured by control GFP RNA or co-injected fluorescent tracer and we assumed a similar efficiency with unlabelled reagents. DFC-directed βcat55-C RNA was sufficient to cause abnormal heart jogging and altered lefty1/2expression, whereas control RNA injection had no change in lefty1/2expression (Fig. 5H,I). To confirm that the induced defects were due to activated β-catenin at biologically relevant levels, we utilized DFC-targeted Axin1-MO(antisense morpholino oligo), a known negative regulator of β-catenin(Heisenberg et al., 2001). Axin1 knockdown in the DFC region leads to ectopic nuclearβ-catenin (Fig. 5E). However, the modest impact of Axin1 knockdown on lefty1/2expression reflects the efficiency of the DFC-targeting; this effect was significant and was sufficient to alter KV formation (see Fig. S5 in the supplementary material). Therefore activated β-catenin in the DFCs is sufficient to alter KV formation and subsequent organ laterality.

To verify that Ca²⁺ activity in the DFC region is critical for KV formation, we utilized DFC targeting of additional Ca²⁺ release inhibitors. KV formation was normal in wt or control-injected (DFC targeting of DMSO) embryos (see Fig. S5 in the supplementary material). Consistent with global thapsigargin treatment, DFC targeting of thapsigargin, or valproate(inositol turnover inhibitor) disrupted KV formation (see Fig. S5 in the supplementary material). Taken together, these data affirm that the defects we observe are primarily due to intracellular Ca²⁺ release inhibition in the DFC region.

Our data provide evidence that early Ca²⁺ release in the zebrafish DFC region is necessary for proper KV formation and subsequent LR asymmetry by antagonism of β-catenin. In Xenopus, several pieces of evidence suggest that early Ca²⁺ activity near cells with DFC-like properties could be a conserved mechanism for establishing laterality. First, Ca²⁺ release activity has been described near the late organizer region in Xenopus gastrula stage embryos(Webb and Miller, 2006). Second, stage 13 Xenopus embryos have a cluster of left-right dynein-expressing cells in the dorsal blastopore(Essner et al., 2002) and finally, stage 15 embryos have recently been shown to have motile cilia with left-ward fluid flow in a node-like structure(Schweickert et al., 2007). Thus, we explored the possibility that Xenopus embryos have a population of endocytically active cells, which ultimately contribute to the tailbud and form a ciliated structure, analogous to zebrafish DFCs(Cooper and D'Amico, 1996). Syto-11 uptake in late gastrula embryos (stage 11.5) revealed accumulation of labeled cells in the dorsal mesoderm of the tail region of embryos sagittally bisected at stage 14 (Fig. 6A)and stage 17 (neurula) (Fig. 6B). Archenteron roof tissue explants from stage 17 embryos showed Syto-11 staining of the node (Fig. 6C, arrow) and surrounding lateral plate mesoderm. Subsequent immunostaining of the explants for acetylated tubulin showed enrichment of cilia in the node region (Fig. 6D, arrow). These data establish that highly endocytic cells in the late gastrula preferentially contribute to the node region in Xenopus.

To determine the extent to which these endocytically active cells share Ca²⁺ sensitivity, we manipulated Ca²⁺ release in Xenopus, at a comparable stage of gastrulation (stage 11.5), and using a similar limited exposure as in zebrafish. We visually scored heart and gut laterality after stage 45 (Yost,1992). Normal organ placement (situs solitus), with the heart ventricle situated on the left side and the outflow tract looping to the right and concomitant counterclockwise coiling of the gut, was observed in 100% of wt and control-treated embryos (Fig. 6E, arrow and M). In thapsigargin-treated embryos, we observed heart-looping and gut-coiling defects (Fig. 6F, arrow and M). Endogenous Xenopus nodal-related 1(xnr1) expression is detected asymmetrically in the left LPM at stages 22-24 (Fig. 6G,M). Thapsigargin-treated embryos displayed abnormal xnr1 expression(Fig. 6H,M), showing loss of xnr1 or bilateral expression in the posterior LPM. Furthermore,thapsigargin treatment was sufficient to induce ectopic nuclear β-catenin on both sides of a stage 13 Xenopus embryo compared with the control(Fig. 6I-J and see Fig. S6 in the supplementary material) and as in zebrafish, brief thapsigargin treatment did not alter overall axial anterior-posterior and dorsal-ventral patterning(Fig. 6K,L). In conclusion,these data show that Xenopus embryos have endocytically active cells at the late gastrula stage, which contribute to tissues in the tail, similar to zebrafish DFCs. Also, a short pulse of Ca²⁺ inhibition during Xenopus gastrulation is sufficient to generate ectopic nuclearβ-catenin before node formation and cause laterality defects as observed in zebrafish. These results suggest a conserved Ca²⁺-sensitive event involving cells with DFC-like properties in LR patterning in non-mammalian vertebrates.

Here we report endogenous local Ca²⁺ release in the zebrafish DFC region and show that brief inhibition of Ca²⁺ release during epiboly results in altered DFC coalescence/cohesion, defective KV formation,and disrupted expression of asymmetrical LR signals as well as concordant alteration of organ laterality. We identify β-catenin activity as a candidate target of this Ca²⁺ signaling. These observations link endogenous local Ca²⁺ fluxes and β-catenin regulation to the proper establishment of the KV and subsequent LR asymmetry in the zebrafish embryo. Additionally, we define a DFC-like cell population in Xenopusembryos and demonstrate that these cells share a similar Ca²⁺-sensitive stage, and exhibit ectopic nuclear β-catenin resulting in altered laterality upon Ca²⁺ perturbation. Our results in both zebrafish and Xenopus identify an early Ca²⁺-sensitive phase relevant to LR patterning that precedes the Ca²⁺ fluxes linked to cilia-driven nodal flow.

Pan-embryonic Ca²⁺ waves during epiboly/gastrula stages are believed to coordinate convergent extension (CE), the lengthening and narrowing of groups of cells, as well as their directed migration to the future dorsal side (Wallingford et al.,2001; Wallingford et al.,2002). Genetic data supports this idea, in that zebrafish homozygous zygotic Wnt-5 mutants (pipetail) display CE defects and have reduced Ca²⁺ release frequency(Westfall et al., 2003a). In fact, thapsigargin treatment during 30-50% epiboly resulted in cell movement defects and a shortened anterior-posterior axis (data not shown), consistent with previously described thapsigargin-induced phenotypes(Creton, 2004). However, brief thapsigargin treatment of epiboly/gastrula stage zebrafish and Xenopus disrupts laterality without perturbing normal cell movement. Similar laterality defects are generated with additional inhibitors(valproate, to disrupt inositol levels, XeC, to inhibit IP₃-induced Ca²⁺ release and cyclopiazonic acid, to deplete endoplasmic Ca²⁺ stores) and confirm the requirement for early intracellular Ca²⁺ release in KV formation. DFC-targeting of inhibitors supports the conclusion that the Ca²⁺ requirement resides in a small population of cells, as opposed to global signaling over the entire embryo.

Asymmetrical Ca²⁺ levels across the mouse and chick node have been implicated in LR axis determination(McGrath et al., 2003; Raya et al., 2004). The zebrafish KV contains monociliated cells similar to those found in the mouse node and several studies support a link between the node/KV and LR patterning(Brueckner, 2001; Essner et al., 2005; Hashimoto et al., 2004; Supp et al., 1999; Supp et al., 1997). Studies in zebrafish have established a role for inositol polyphosphates, important intracellular second messengers, in LR patterning. Inositol polyphosphate kinases (Ipk) use IP₃ as a template to generate higher inositols(IP₄, IP₅ and IP₆), and play key roles in maintaining Ca²⁺ homeostasis by regulating the concentrations of IP₃ and other inositols (Xia and Yang, 2005). ipk1 knockdown in zebrafish disrupts laterality, resulting in right-sided or bilateral spaw expression(Sarmah et al., 2005). However, ipk1 is not expressed in the DFCs and in ipk1knockdown embryos, KV morphology is normal and cilia are present(Sarmah et al., 2005). Recent work has also postulated a distinct Ca²⁺ requirement in the regulation of KV cilia motility in zebrafish(Shu et al., 2007). These previous studies describe changes in laterality after KV formation. Our findings indicate a novel early role for Ca²⁺ in the DFCs for KV formation. Interestingly in our current study, we found that embryos treated with thapsigargin during tailbud and early somite stages did not have any impact upon KV formation or organ laterality. We used a fluorescent-labeled thapsigargin and noted that upon treatment during epiboly stages, labeled thapsigargin penetrated the YSL and DFC regions (data not shown). Conversely,treatment after tailbud and during somite stages revealed that labeled thapsigargin does not penetrate the region of the embryo where the KV resides. Thus a negative result with thapsigargin treatment at later stages (i.e. somite stages) may be a reflection of failure of the reagent to permeate into the target tissues.

We propose that epiboly stage Ca²⁺ release is required to regulate β-catenin activity in the DFC region. Ca²⁺ inhibition for a discrete time period resulted in a statistically significant increase in nuclear β-catenin and activation of β-catenin transcriptional reporters, including TOPdGFP transgenic embryos and TopFlash assays. In fact,we observe TopFlash activation as early as 20 minutes after addition of thapsigargin, and this activation occurs hours before somitogenesis, KV and cilia formation. This activation is confirmed in the whole embryo by use of the TOPdGFP transgenic line. We also show that DFC endocytic activity and marker gene expression (ntl, lrdr, sox17 and squint) are maintained in Ca²⁺-inhibited embryos. Based on in vivo imaging and Syto-11 staining, DFC cell number remained unchanged; however migration within the tailbud region was altered. The labeled cells in the tailbud appear dispersed and did not coalesce into a KV. This may be due to altered cell adhesion, polarized cell movement or failure to undergo a mesenchymal-to-epithelial transition. All are processes that can be perturbed with altered Wnt signaling or β-catenin levels.

Our data provide evidence for an early Ca²⁺-dependent cascade that ultimately regulates β-catenin levels and promotes KV formation. Murine Wnt3a has been shown to be necessary in LR coordination, but after the node cilia have formed (Nakaya et al.,2005). Our findings indicate a critical role for Ca²⁺release and β-catenin activity, specifically in the DFC region before somitogenesis. This may be mediated by Wnt/Ca²⁺ antagonism of Wnt/β-catenin (Slusarski et al.,1997; Torres et al.,1996), however the Wnt/Ca²⁺ ligand is not identified in this study. Since the DFCs do not form a KV in both thapsigargin-treated and Axin1-MO injected embryos, we cannot evaluate effects on cilia-dependent laterality cues, but we do observe a loss of charon expression. It should be noted that in charon knockdown embryos, the KV remains intact while laterality is altered (M.R., unpublished observations). Conversely, knockdown of Bardet-Biedl Syndrome genes in zebrafish embryos eliminates the morphological aspects of the KV and KV cilia but charon is still present (Yen et al., 2006). Furthermore, charon knockdown generates a preponderance of embryos with bilateral expression of laterality markers(Hashimoto et al., 2004). Since Ca²⁺ inhibition eliminates charon expression, this loss of charon can explain the high incidence of bilateral marker gene expression in thapsigargin-treated embryos in the presence of an intact midline.

The dramatic impact upon LR signaling caused by a transient pulse of Ca²⁺ inhibition would suggest a key patterning event and would also be predicted to be shared with other vertebrates. In Xenopus, we identified a population of endocytically active cells that ultimately surrounded the putative frog node, thus defining DFC-like properties in another vertebrate. Ca²⁺-release inhibitors targeting the equivalent developmental stage in Xenopus, induced ectopicβ-catenin, organ laterality defects and bilateral nodal(Xnr-1) expression.

In summary, we have identified an early local Ca²⁺ release in the DFC region and show that inhibition of this activity via DFC-targeted injections results in dramatic KV defects. Furthermore, we implicateβ-catenin activity as the target of the endogenous DFC Ca²⁺fluxes and we show that suppression of β-catenin signaling within the DFCs is necessary for appropriate LR patterning in zebrafish and Xenopus. Thus, antagonisms between Wnt/Ca²⁺ and Wnt/β-catenin pathways may be crucial not only for dorsal-ventral patterning but for KV morphogenesis and LR asymmetry.

We thank H. Griesbach and T. Westfall for technical assistance and Slusarski lab members for comments on the manuscript. This work was supported by the American Heart Association pre-doctoral fellowship to I.S., Carver Charitable Trust Grants to M.R.R. and D.W.H. and by National Institutes of Health grant CA112369 to D.C.S.