Molecular analysis of the deletion mutants in the E homeotic complex of the silkworm Bombyx mori

Genetical studies revealed that the identities of the body segments are determined by homeotic genes in many kinds of insects (Ouweneel, 1976). In the fruit fly Drosophila melanogaster, the red flour beetle TriboHum castaneum (Beeman, 1987) and the silkworm Bombyx mori (Hashimoto, 1941), homeotic genes are clustered in homeotic gene complexes. In Drosophila, the Antennapedia complex (ANT-C) (Wakimoto and Kaufman, 1981) and the bithorax complex (BX-C) (Lewis, 1978), which are located on the right arm of the third chromosome, specify the identities of the body segments or parasegments. ANT-C determines identities of the head to the middle thoracic segment and BX-C determines identities of the posterior thoracic segment and all the abdominal segments. Molecular studies of the structure of ANT-C and BX-C revealed that these gene complexes consist of homeobox genes (Gehring and Hiromi, 1986). In BX-C, three homeobox genes, Ubx, abd-A and Abd-B are involved in the determination of the abdominal segments in Drosophila (Duncan, 1987). In Tribolium, similar homeotic genes are known to determine the identities of the body segments. Beeman demonstrated that six loci of homeotic genes are clustered in the second linkage group of Tribolium (Beeman, 1987) and these loci include elements with homology to the homeotic genes in the ANT-C and BX-C in Drosophila.

The E loci in B. mori contain homeotic genes specifying the identities of the larval abdominal segments (Hashimoto, 1941; Tazima, 1964). This homeotic gene complex is thought to be located on the 0.0 locus of the sixth chromosome linkage group in Bombyx, and over thirty types of mutations were found and analyzed for pseudoallelism. All of these mutations are dominant and induce expression of the extra markings or the supernumerary legs in the abdominal segments. Most of the mutations in the E complex are lethal in the homozygous condition.

The E complex reveals one interesting aspect different from the homeotic gene complexes of Drosophila. Most of the E mutations cause a particular directional shift, anterior to posterior or vice versa, on both the dorsal and ventral sides of larvae. However, some E mutations cause shifts in one direction on the dorsal side and in the opposite direction on the ventral side (Itikawa, 1943; Tazima, 1964). Since such an independent determination on the dorsal side and ventral side in larvae has not been observed in Drosophila, there must be differences in the regulatory mechanisms that specify abdominal segments between Bombyx and Drosophila.

To understand how the E complex specifies the identities of body segments on the dorsal side and ventral side of larvae independently, it is necessary to know the molecular structure of the E complex. Since some mutations in the E complex are associated with phenotypes similar to those of the mutations in the bithorax complex, we assumed that the E complex might be analogous to the Drosophila bithorax complex. In this report, we describe the isolation of three Bombyx genomic fragments that are probably homologues of the Ubx, abd-A and Abd-B in Drosophila. Analyses with the two types of mutant chromosomes, E^N and E^ca showed that the Bombyx Ubx and abd-A genes are deleted in the E^N chromosome, and the Bombyx abd-A gene is deleted in the E^Ca chromosome. These results suggest the E complex consists of the homeobox genes and is similar to the bithorax complex in Drosophila.

Bombyx eggs and larvae of mutant strains f12 carrying E^N chromosome and f21 carrying E^Ca chromosome were gifts from Dr H. Doira, Institute of Genetic Resources, Kyushu University. Embryos were developed at 25°C for about 5 days to stages 22 or 25 (Takami and Kitazawa, 1960) and dissected out from eggs under a binocular microscope. Larvae of a commercial strain of B. mori (Kin-Shu × Sho-Wa from the Kanebo Silk Co., Kasugai City, Japan) were reared at 27°C on an artificial diet from Kyodo Shiryo Co. (Yokohama, Japan).

Isolation of Bombyx Ubx gene was performed following the PCR amplification method as described (Kamb et al., 1989). DNA fragments containing homeobox regions were amplified from genomic DNA with fully degenerated primers that correspond to two consensus amino-acid sequences, 5′ELEKEFH3′ and 5′IKIWFQN3′, in the homeodomain. The reaction mixture of the PCR amplification was incubated in a Perkin Elmer Cetus thermocycler for 25 cycles; 1 min at 94°C, 2 min at 37°C, and 3 min at 55°C (Saiki et al., 1985). After amplification, the DNA fragments were subcloned into a plasmid vector pGEM3Zf(+). Clones containing Bombyx Ubx were identified by sequencing. Clones carrying longer genomic fragments were isolated from a genomic library with a probe that was amplified from the subclone. The Bombyx genomic library (2 × 10⁵ clones) was constructed by size fractionating a Mbol partial digest of posterior silk gland DNA from Bombyx (the Kanebo strain, Kin-Shu x Sho-Wa) and ligating the 30-45 kb fraction into the BamHI site of pWE15 cosmid vector (Stratagene Co.) (Evans and Wahl, 1987). Hybridization was performed at 65°C for 2 hours using Amersham Rapid Hybridization kit. After blots were washed in 2 × SSC containing 0.1% SDS (sodium dodecyl sulfate) at 65°C for 3 hours, positive clones were detected by autoradiography. Since the screening probe hybridized to a 7.0 kb EcoRI fragment, this fragment was subcloned into plasmid vector and sequenced with fully degenerated primers that correspond to two consensus amino-acid sequences in homeodomain as described above.

For the isolation of Bombyx abd-A and Abd-B genes, the Bombyx genomic cosmid library was screened by crosshybridization with the homeobox regions of the abd-A and Abd-B genes of Drosophila. The homeobox region of Drosophila abd-A was amplified from abd-A genomic DNA p53 with two primers, 5′CCCCCCCAACGGCTGTCCAC-GAAG3′and 5′CTCACCTGTTCAITTATTTCCTTG3′ (Regulski et al., 1985). Drosophila Abd-B probe was amplified from Abd-B cDNA E61 by PCR with two primers 5′CAGGTGTCCGTCCGGAAAAAGCGC3′ and 5′GTTC-AGGTGGTGGCCGCTGTGGTG3′ (Zavortink and Sakonju, 1989). The hybridization conditions were the same as described above. The Drosophila abd-A probe hybridized to a 2.5 kb HindIII fragment, and the Drosophila Abd-B probe hybridized to a 5.0 kb HindTII fragment. Therefore these fragments were subcloned and sequenced as described above.

The heterozygous E^N/+ and EF“I+ DNAs and the wild-type +/+ DNA for Southern blot analysis were extracted from the posterior silk glands of the fifth instar larvae by the method described previously (Gross-Bellard et al., 1973). We started DNA extraction from two pairs of the posterior silk glands which were stored at —80°C. Posterior silk glands were ground under liquid nitrogen and suspended in 500 /d of digestion buffer (100 mM NaCl, 10 mM Tris-HCl (pH 8.0), 25 mM EDTA (pH 8.0), 10% SDS and 0.1 mg/ml Proteinase K) and incubated at 50°C for 12 hours. DNAs were extracted with phenol-chloroform-isoamylalchol (25:24:1). After 1/2 volume of 7.5 M ammonium acetate and 2 volumes of ethanol were added to DNA solution, long-size DNAs were wound up with a pipette tip and dissolved in TE buffer (10 mM Tris-HCl (pH 8.0) and 1 mM EDTA). Quantities of DNA were estimated by diphenylamine reaction (Burton, 1956).

For PCR analysis, DNAs were prepared from the homozygous E^N/E^N and E^Ca/E^Ca embryos and the wild-type embryos by the method described (Jowett, 1986). After the embryos were dissected under a binocular microscope in 1 x SSC at room temperature, mutant and wild-type embryos were washed in 1 x SSC twice and stored at —80°C. Since embryos with the +/+ genotype or E^N/+ or E^c7+ genotype cannot be distinguished, we extracted DNA from individual embryos of apparent wild-type phenotype (either E^N/+ or +/+, EE^a/+ or +/+ ) and apparent E^N/E^N or E^àa/E^Ca phenotype. Each embryo was suspended in 25 μ l of a buffer containing 10 mM Tris-HCl (pH 7.5), 60 mM NaCl, 50 mM EDTA, 0.15 mM spermine and 0.15 mM spermidine, and ground with a pipette tip. After 25 μ l of a solution containing 1.25% SDS, 0.3 M Tris-HCl (pH 9.0), 0.1 mM EDTA, 5% sucrose, and 0.75% freshly added diethylpyrocarbonate were added, solutions were incubated for 40 minutes at 60°C. SDS and protein were precipitated by centrifugation after addition of 30 μ l of 8 M potassium acetate and cooling for 45 minutes on ice. DNAs were precipitated by adding 2 volumes of ethanol and dissolved in 25 μ l of TE buffer.

Southern blot analysis of heterozygous mutant DNA After each 3 pg of DNA extracted from the E^N/+ or E^Co/+ and +/+ larvae were digested with EcoRI, Southern blot analyses were performed sequentially with randomly primed specific DNA probes which are located 3′ to each homeodomain. A 296-bp DNA probe was prepared for the analysis of Bombyx Ubx by PCR amplification from cloned Bombyx Ubx DNA with two primers, 5′TGAACGAGCAGGA-GAAACAGGCGC3′ and 5′TCCAACAGTTTATTGTTC-GTATCA3′. A 341-bp DNA was amplified for the analysis of the Bombyx abd-A gene with two primers 5′AACAG-GCTCGCCGCGAAAGAGAGG3′ and 5′CCTTCACAA-CAAGACGACACIT CC3′. A 287-bp DNA was amplified for the analysis of the Bombyx Abd-B gene with two primers 5′AACAACAATTCAAATGCGAACAAC3′ and 5′GCA-TACAACGTTCTCCGGTCAATT3′. Hybridization was performed at 65°C for 2 hours with Amersham Rapid Hybridization kit and blots were washed in 0.3 × SSC buffer containing 0.1% SDS at 65°C. Hybridization patterns were analyzed and extents of hybridization were estimated with a Bio-Image Analyzer (BAS 2000, Fuji Photo Film Co., LTD).

DNAs extracted from individual embryos were subjected to 25 cycles of amplification by PCR, at an annealing temperature of 45°C, using the mixed primers used in the preparation of the probes just 3′ to the homeodomains of the Bombyx Ubx, Bombyx abd-A and Bombyx Abd-B genes as described above. After amplified products were separated by electrophoresis on a 2% agarose gel and transferred to membrane filter by Vacuum Blot (LKB Co.), blots were used for rehybridization with the probes for the Bombyx Ubx, Bombyx abd-A and Bombyx Abd-B genes. Hybridization was performed at 65°C for 2 hours and blots were washed in 2 × SSC containing 0.1% SDS for 30 minutes.

Itikawa (1943) reported that embryos homozygous for the E^a (new additional crescent) mutation express many thoracic-typ^e appendages in would-be abdominal segments and die at the late embryonic stages. As shown in Fig. IB, homozygous E^N/E^N embryos express thoracic-type legs from the first to the seventh abdominal segments (Al to A7) and intermediate thoracic/ab-dominal-type legs in the A8 segment. Itikawa (1943) also reported that the nerve commissures and the tracheae in the first to the eighth abdominal segments in the embryos homozygous for E^N show the patterns similar to those in the thoracic segments of normal embryos. From these observations, Itikawa proposed that the first to the seventh or eighth abdominal segments in homozygous E^N/E^N embryos are transformed to the thoracic-type segments.

In Drosophila, the bithorax complex consists of three homeobox genes, the Ubx, abd-A and Abd-B. Lewis reported that the functional deficiency of the Ubx and abd-A (DfUbx¹⁰⁹) causes the transformation of most abdominal segments to the thoracic-type segments in Drosophila (Lewis, 1978). From the similarity of the phenotype between the homozygous E^N embryo and DfUbx¹⁰⁹ embryo, we assumed that the E complex has a similar structure and function to the bithorax complex in D. melanogaster.

Itikawa (1943) also reported that the embryos homologous for E^Ca (additional crescent) reveal three pairs of normal thoracic legs in the thoracic segments, but no abdominal legs in the abdominal segments. The abnormality of the homozygous E^Ca embryos is shown in Fig. 1C. We speculated that the A3 to A6 segments, which normally reveal abdominal legs, might have transformed to other abdominal segments that have no leg. Which abdominal segment repeats at the position of the A3 to A6 segments in the embryos homozygous for E^Ca was not determined.

To determine whether the E complex consists of homeobox genes similar to Drosophila Ubx, abd-A and Abd-B, we screened the Bombyx genome to isolate the homologues. First we performed PCR amplification to isolate of Bombyx homeobox genes using the degenerated oligonucleotides primers corresponding to the consensus amino-acid sequences in homeodomain (see Materials and Methods). With this method, we expected to obtain homologues of Drosophila Ubx and abd-A genes, because Ubx and abd-A genes contain the consensus amino-acid sequences. Although we sequenced many clones prepared by subcloning of the amplified DNA, we could obtain only the gene that seems to be a homologue of the Drosophila Ubx gene. Using the 112 bp DNA fragment amplified from the subclone, we screened the Bombyx genomic library and isolated longer DNA fragments which contain the corresponding homeobox region.

Fig. 2 shows the comparison of the nucleotide and amino-acid sequences between genomic fragment of Bombyx Ubx and cDNA of Drosophila Ubx. The nucleotide sequences of the homeobox region and the flanking regions of Bombyx Ubx (nucleotide position 23 to 276) were 77% homologous to those of Drosophila Ubx. The 80 amino acids for the homeodomain and the flanking regions encoded by both Ubx genes were identical. The Drosophila Ubx gene contains an intron just 5′ to the homeobox as indicated in Fig. 2 (Komfeld et al., 1989). Since the putative amino acid sequences encoded by the Bombyx Ubx following the corresponding position were homologous to those of Drosophila Ubx, the Bombyx Ubx gene might also contain an intron at the same position.

To isolate of Bombyx homologues of abd-A and Abd-B genes, the genomic library was screened by crosshybridization with the homeobox regions of the abd-A and Abd-B genes of Drosophila. Figs 3 and 4 show the comparison of the nucleotide and amino-acid sequences between Bombyx genes and Drosophila cDNAs. The nucleotide sequences of the homeobox and flanking regions of the Bombyx abd-A (nucleotide position 13 to 276) were 77% homologous to those of the Drosophila abd-A gene. The 86 amino acids encoded by the Bombyx abd-A gene were identical to those of Drosophila abd-A cDNA (Karch et al., 1990). A homologue of abd-A was isolated from the locust Schistocerca gregaria and the amino-acid sequences including the homeodomain and its flanking regions were found identical to the corresponding regions of Drosophila abd-A (Tear et al., 1990). Although the Drosophila abd-A gene has a short intron at the position just 3′ to the homeobox as indicated in Fig. 3, this intron was absent in the abd-A homologue from Schistocerca. Since the putative amino-acid sequences in the 3′ flanking region of the Bombyx abd-A gene were also identical to the sequences of Drosophila abd-A cDNA, the Bombyx abd-A gene probably does not have an intron at the 3′ flanking region of the homeobox.

The homology of the nucleotide sequences between Bombyx Abd-B gene (nucleotide position 19 to 234) and Drosophila Abd-B cDNA was as high as those of the abd-A and Ubx genes (79% homologous). In the homeodomains of both Abd-B genes, only one amino acid was different, but the asparagine residue in Bombyx has a similar property to the glutamine residue in Drosophila. The Drosophila Abd-B gene also contains an intron in the homeobox region (DeLorenzi et al., 1988). Since the putative amino-acid sequences in the homeobox region of Bombyx Abd-B gene were identical to the sequences of cDNA of the Drosophila Abd-B gene, the Bombyx Abd-B gene probably does not have this intron. Compared with the similarities of the Ubx and abd-A genes between Bombyx and Drosophila, the homology of the amino-acid sequences of the 3′ flanking region of the Abd-B genes was not so high.

These conservations of the homeodomain amino-acid sequences between Bombyx and Drosophila suggest that these Bombyx homologues may have functions analogous to their Drosophila counterparts. Therefore, we name these genes Bm Ubx, Bm abd-A and Bm Abd-B, respectively.

To examine the abnormalities in the E^A chromosome, we performed a Southern blot analysis of the heterozygous E^N/+ chromosome and an amplification analysis by PCR of the homozygous E^N/E^N chromosome. The homozygous E^N/E^N chromosome is the best for analyses of chromosomal abnormalities, but sufficient quantities of DNA for a Southern analysis cannot be easily obtained because of the embryonic lethality of homozygosity. Therefore, first we performed a Southern blot analysis on heterozygous E^N/+ DNA. We used a probe fragment just 3′ to the homeodomain of the Bombyx genes (Fig. 5A-5C) to prevent a crosshybridization. Die Bm Ubx probe hybridized to 6.7 kb fragments from both heterozygous E^N/+ and wild-type +/+ DNAs digested with EcoRI, but a quantitative analysis revealed that the extent of hybridization (as determined by the intensity of signals from hybridized bands) with heterozygous E^N/+ DNA was about a half of that with wild-type +/+ DNA (Fig. 5A). Also, the heterozygous E^N/+ DNA contained only a half amount of a 7.4 kb fragment hybridized with Bm abd-A probe compared to wild-type +/+ DNA (Fig. 5B). However, the extent of hybridization with the Bm Abd-B probe was almost the same for E^N/+ and wild-type DNAs (Fig. 5C).

These results strongly suggested that the Bm Ubx and abd-A regions are deleted in the E^N chromosome of Bombyx. To confirm this further, we examined whether the DNA fragments just 3′ to the homeodomains of Bombyx genes could be amplified from the homozygous E^N/E^N chromosome by PCR (Fig. 5D-5F). Amplified DNA fragments were detected by Southern blot analysis with specific probes to the Bombyx homeobox genes. In the case of Bm Ubx gene, the DNA fragment was amplified from DNAs extracted from three individual wild-type embryos, while no appropriate product was amplified from DNAs from three individual embryos homozygous for E^N/E^N. Similar results were obtained in the case of the Bm abd-A gene; no amplified product was detected from DNAs extracted from embryos homozygous for E^N/E^N. However, amplifications of the Bm Abd-B gene were detectable from DNAs extracted from embryos homozygous for E^N.

Structural and functional analysis of the E complex was carried out also on chromosome. Southern blot hybridization revealed that the extent of hybridization with the Bm Ubx probe in the heterozygous E^ca/+ DNA was the same as in wild-type +/+ DNA (Fig. 6A), while that of the Bm abd-A in the heterozygous E^Ca/+ DNA was a half of that of wild-type +/+ DNA (Fig. 6B). For the Bm Abd-B gene from the heterozygous E^Ca/+ chromosome, two fragments (5.0 kb and 1.5 kb) of a comparable intensity were detected (Fig. 6C). Since the total intensity of Bm Abd-B hybridization on the 5.0 kb and 1.5 kb fragments from the heterozygous chromosome was the same as the intensity of 1.5 kb fragment from the wild-type chromosome, restriction polymorphisms with the heterozygous chromosome might have caused the two fragments. By PCR amplification on the homozygous E^ca/E^ca chromosome, no product was detected for the Bm abdA gene (Fig. 6E), while appropriate products were detected for the Bm Ubx (Fig. 6D) and Abd-B genes (Fig. 6F). These results suggest that the Bm abd-A gene is deleted in the E^Ca chromosome.

We have isolated Bombyx Ubx, abd-A and Abd-B genes, and shown that the amino-acid sequences including the homeodomain and its flanking regions of these genes are almost identical to those of Drosophila Ubx, abd-A and Abd-B. The conservation of the homeodomain amino-acid sequences between Bombyx and Drosophila suggests that Bombyx homologues may have similar functions to those of Drosophila.

We have also isolated the Antennapedia (Antp), Sex combs reduced (Serf engrailed (en), invected (in) homologues from Bombyx (W. Hara and Y. Suzuki, unpublished data; K. Ueno, unpublished data; Hui et al., 1991). The homeodomain sequences of the Bombyx Antp and Scr were also homologous to those of Drosophila Antp and Scr, respectively. Four highly conserved domains, including the homeodomain, were identified in en and in proteins from Bombyx and Drosophila (Hui et al., 1991). These conservations suggest that the common amino-acid sequences of the homeodomain and flanking regions are necessary for specifying the body segments.

Since the homeodomain is important to express the function of the homeoprotein and our results indicate that the homeodomain regions of the Bm Ubx and abd A genes are deleted in the E^N/E^N chromosome, we speculate that complete functional deficiency of the Bm Ubx and abd-A genes may have caused the transformation of the Al to A7 segments to the thoracic type segments in the homozygous E^N embryos (Fig. IB). Observation of intermediate thoracic/abdominal-type legs in the A8 segment suggests that the Bm Abd-B gene may be functional in the homozygous E^Nembryos.

In Drosophila, the deletion mutations of the Ubx and abd-A genes such as DfUbx¹⁰⁹ cause the transformation of the Al to A7 segments to the thoracic-type segments (Lewis, 1978), and the A8 segment expressed abdominal-type phenotype in DfUBx¹⁰⁹ mutant. The similarity of the phenotypes of the homozygous E^N/E^N embryos and the DfUbx¹⁰⁹ embryos suggests that the Bm Ubx, abd-A and Abd-B genes have similar functions to the Drosophila genes.

In Drosophila, functional deficiency of the abd-A gene is thought to cause the transformation of the A2-A7 segments to Al type segments (Lewis, 1978). By analogy, we infer that a complete deficiency of abd-A function in homozygous E^Ca/E^Ca embryos may have caused the transformation of the A2-A7 segments to Al type segments, which have no abdominal legs.

These analyses on E^N and E^ca chromosomes suggested that the deletions of Bm Ubx and/or abd-A genes are responsible for the phenotypes of these E mutants and functions of these genes are analogous to those of homologues in the BX-C. No chromosomal abnormality was detected at the homeobox region of the Bm Abd-B gene in either the E^N or E^Ca chromosome. Nevertheless, we speculate that the E complex also contains the Bm Abd-B gene for the following reasons. It is known that the E^Ds (Double stars) causes abnormal specification of segments flanking the A5 segment (Takasaki, 1947). This phenotype seems to resemble the phenotype associated with Abd-B mutation in Drosophila (Duncan, 1987). Therefore, the E complex in Bombyx probably consists of Ubx, abd-A and Abd-B genes and the functions of these homeobox genes resemble those of the Drosophila BX-C.

From our results, we think that the E loci accommodate a gene complex analogous to BX-C. Lewis has suggested the hypothesis that ‘leg-suppressing’ genes ancestral to the bithorax complex are responsible for removing the legs from abdominal segments of millipede-like ancestors during the evolution of the arthropod (Lewis, 1978). The E^N/E^N embryo with its many thoracic-type legs may appear to express atavie characteristics by the deletion of some ‘leg-suppressing’ genes.

Recently, we demonstrated that the Nc locus at 1.4 genetic units from the E loci probably contains Bombyx Antp gene (T. Nagata, unpublished data). This observation suggests that the Nc locus may constitute a complex analogous to Drosophila ANT-C. Therefore,

The E complex is different in one important respect from the Drosophila BX-C. Some E mutations like E^Kp/E^Kp (Kp supernumerary legs) (Hashimoto, 1941) and E^D/ + (Double crescents) (Hashimoto, 1930) cause shifts in one direction on the dorsal side and to the opposite direction on the ventral side (Tazima, 1964). Since such an independent determination of the two sides is not seen in Drosophila, there must be differences between the Bombyx E complex and the bithorax complex of Drosophila in the regulatory mechanisms that specify abdominal segments. Further detailed analyses are required to determine these differences.

We thank Dr H. Doira for the eggs and larvae of E group mutants of the silkworm; Drs A. Kuroiwa and S. Sakonju for Drosophila homeobox genes; Drs T. Suzuki, K. Mastuno, W. Hara, S. Takiya and T. Tamura for critical discussions; and Mrs E. Suzuki, M. Sasaki, M. Ohkubo, and M. Nasu for technical assistance. This work was partly supported by Grants-in Aid for Research of Priority Areas and a research grant from the TERUMO Life Science Foundation.